View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12142_low_18 (Length: 274)
Name: NF12142_low_18
Description: NF12142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12142_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 256
Target Start/End: Complemental strand, 17814493 - 17814252
Alignment:
| Q |
15 |
gttctgatcccaatacaataaggttggaagggtgaaggttcaacaaccatatcaaaaatcataaatataagataggtgcattcatacaacgggattgggt |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17814493 |
gttctaatcccaatacaataaggttggaagggcgaaggttcaacaaccatatcaaaaatcatgaatataagataggtgcattcatacgacgggattgggt |
17814394 |
T |
 |
| Q |
115 |
ttttctataatataatcaatatccaatttctatttaagccatggggttttgcatacactttcctcatatcataccaatagaacttgttttcttgcttcta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17814393 |
ttttctataatataatcaatatccaatttctatttaagccatggggttttgcatacactttcctcatatcataccaatagaacttgttttcttgcttcta |
17814294 |
T |
 |
| Q |
215 |
tcatattagtttcttccaagaatggtgctcactggtaaactt |
256 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
17814293 |
tcatattagtttcttccaaggatggtgctcaatggtaaactt |
17814252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University