View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12142_low_20 (Length: 272)

Name: NF12142_low_20
Description: NF12142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12142_low_20
NF12142_low_20
[»] chr4 (1 HSPs)
chr4 (8-272)||(2465748-2465995)
[»] chr5 (1 HSPs)
chr5 (152-246)||(16130962-16131056)


Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 8 - 272
Target Start/End: Original strand, 2465748 - 2465995
Alignment:
8 tatattaatactatgagaacaaagaaataggacataaaacata---catcctaagaaaagtgtaagttgggaaattgcaaaggcttatacaaaactcttt 104  Q
    |||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
2465748 tatattaatactatgagaacaaagaaataggacataaaacatagtacatcctaagaaaagtgtaagttgggaaattgcaaaggct-atacaaaactcttt 2465846  T
105 gattggtaatgatcccctattagttgatgcataacttccaaaagagaaccgactttccgtcttcttccagaatttagaattcaaaaagtcagtacttgat 204  Q
    ||| |||||||||||||||||||||||||||                   ||||||||||||||||||||||||||||||||||||||||||||| ||||    
2465847 gataggtaatgatcccctattagttgatgca-------------------gactttccgtcttcttccagaatttagaattcaaaaagtcagtacatgat 2465927  T
205 agcttgcaacacatgtcttgtacggcatcagtattaggaatcatttatgaaaacaacttatatcttat 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
2465928 agcttgcaacacatgtcttgtacggcatcagtattaggaatcatttatgaaaacaacttatagcttat 2465995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 152 - 246
Target Start/End: Complemental strand, 16131056 - 16130962
Alignment:
152 accgactttccgtcttcttccagaatttagaattcaaaaagtcagtacttgatagcttgcaacacatgtcttgtacggcatcagtattaggaatc 246  Q
    ||||||| || ||||||||||||||||||||| |||||||||||||||  | |||||||||||||||||| | || |||||||||||| ||||||    
16131056 accgactgtctgtcttcttccagaatttagaactcaaaaagtcagtaccaggtagcttgcaacacatgtcgtctatggcatcagtattgggaatc 16130962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University