View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12142_low_26 (Length: 245)
Name: NF12142_low_26
Description: NF12142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12142_low_26 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 21 - 245
Target Start/End: Complemental strand, 36186311 - 36186087
Alignment:
| Q |
21 |
ggaatactagttaacatttccattaattttttaacatgtgttattgggtcacttcttaaacaaacaaaacttgagcaaaattaaacttgagccaaagctc |
120 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36186311 |
ggaacactagttaacatttccattaattttttaacatgtgttattgggtcacttcttaaacaaataaaacttgagcaaaattaaacttgagccaaagctc |
36186212 |
T |
|
| Q |
121 |
cttctcctacttgttctcgttgcagtcttaaaaacgaaatttttcttcaatgtgtacgagattgcagcttttgccttaggatatggcatcaattaggctt |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||| ||| | ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36186211 |
cttctactacttgttctcgttgcagtcttcaaaacgaaatttttcttcactgtatccgagactgcagcttttgccttaggatatggcatcaattaggctt |
36186112 |
T |
|
| Q |
221 |
cattaattatgagttcttctctccc |
245 |
Q |
| |
|
|| |||||||||||||||||||||| |
|
|
| T |
36186111 |
cactaattatgagttcttctctccc |
36186087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 134 - 245
Target Start/End: Original strand, 21377090 - 21377201
Alignment:
| Q |
134 |
ttctcgttgcagtcttaaaaacgaaatttttcttcaatgtgtacgagattgcagcttttgccttaggatatggcatcaattaggcttcattaattatgag |
233 |
Q |
| |
|
|||||||||||||||| | || || | |||||||| ||||| |||| |||| ||||| ||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
21377090 |
ttctcgttgcagtcttcagaatgagacctttcttcattgtgtttgagactgcaacttttcccttaggatatggcatcaatttggcttcactaattctgag |
21377189 |
T |
|
| Q |
234 |
ttcttctctccc |
245 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
21377190 |
tttttctctccc |
21377201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University