View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12145_high_10 (Length: 355)
Name: NF12145_high_10
Description: NF12145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12145_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 19 - 329
Target Start/End: Complemental strand, 52433188 - 52432878
Alignment:
| Q |
19 |
agatcacatagagaactatgaaaaatagaaagaacatatgcttcattattattattctgttttgtttttccctgccttgtgttgaagcaaatgaagattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52433188 |
agatcacatagagaactatgaaaaatagaaagaacatatgcttcattattattattctgttttgtttttccctgccttgtgttgaagcaaatgaagattc |
52433089 |
T |
 |
| Q |
119 |
tctccgtgtttatttatttatagatggtattttttggaaaataagtgtatatattaatatgatttgccggcttggtggttgaaataagaaaaagaagagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52433088 |
tctccgtgtttatttatttatagatggtatttttaggaaaataagtgtatatattaatatgatttgccggcttggtggttgaaataagaaaaagaagagg |
52432989 |
T |
 |
| Q |
219 |
ggttatgcctggtctggtggtgtatatagtaactaataactagctagcaagcgttgaagtagaactacaatacaacctcacatacattcacgagtcactt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52432988 |
ggttatgcctggtctggtggtgtatatagtaactactaactagctagcaaacgttgaagtagaactaaaatacaacctcacatacattcacgagtcactt |
52432889 |
T |
 |
| Q |
319 |
tcaatatgggt |
329 |
Q |
| |
|
||||||||||| |
|
|
| T |
52432888 |
tcaatatgggt |
52432878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University