View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12145_low_5 (Length: 424)
Name: NF12145_low_5
Description: NF12145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12145_low_5 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 226 - 424
Target Start/End: Original strand, 43687760 - 43687958
Alignment:
| Q |
226 |
gatttagttcctgaaattgaggaggaagatgaagattacgacgtacaagcgccgcaggttttggatgataaattggatagtccctcttctttctatggat |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43687760 |
gatttagttcctgaaattgaggaggaagatgaagattacgacgtacaagcgccgcaggttttggatgataaattggacagtccctcttctttctatggat |
43687859 |
T |
 |
| Q |
326 |
cactctcaatggccgattctggcttcaagaagttcgaagaagatgctttgtatccttatattttgcctctcttttttcttagactaaatttgaagactt |
424 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43687860 |
cactctcaatggccgattctggcttcaagaagttcgaagaagatgctttgtatccttatatcttgcctcccttttttcttagactaaatttgaagactt |
43687958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 19 - 160
Target Start/End: Original strand, 43687553 - 43687694
Alignment:
| Q |
19 |
acagtttcgtttgaagagcttttaggtcactgcaacgaattgtacaagaagaatcaaaccgatctagttgaactcgaagatcgtctaaaaagctgctacg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43687553 |
acagtttcgtttgaagagcttttaggtcactgcaacgaattgtacaagaagaatcaaaccgatctagctgaactcgaagatcgtctaaaaagctgctacg |
43687652 |
T |
 |
| Q |
119 |
gttacgttcaaggtatttgtaagaatgcttgtgatttattaa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43687653 |
gttacgttcaaggtatttgtaagaatgcttgtgatttattaa |
43687694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University