View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12146_high_14 (Length: 248)
Name: NF12146_high_14
Description: NF12146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12146_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 229
Target Start/End: Original strand, 43014960 - 43015177
Alignment:
| Q |
12 |
agagatggattaagcagacactttttccatagaccatcaaaggcatatacaacaggaacacgaaagaggagaaagattcaaaccgaagagtgtgacttac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43014960 |
agagatggattaagcagacactttttccatagaccatcaaaggcatatacaacaggaacacgaaagaggagaaagattcaaaccgaagagtgtgacttac |
43015059 |
T |
|
| Q |
112 |
aaggaagtacaggaggagaaacaagatggcacaaaactggtaagaccagacctgttatggttaatggtaaacaaaaaggttgcaagaaaattcttgttct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015060 |
aaggaagtacaggaggagaaacaagatggcacaaaactggtaagaccagacctgttatggttaatggtaaacaaaaaggttgcaagaaaattcttgttct |
43015159 |
T |
|
| Q |
212 |
ctacaccaactttggaaa |
229 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
43015160 |
ctacaccaacttcggaaa |
43015177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University