View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12146_high_19 (Length: 214)
Name: NF12146_high_19
Description: NF12146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12146_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 14598596 - 14598775
Alignment:
| Q |
18 |
caaagaggtcacaaccaggcagatcagatctccctgtgggattttctggggatggagcatcaaatttctcataaaggacggcaaggtcagtgctacggtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14598596 |
caaagaggtcacaaccaggcagatcagatctccctgtgggattttctggggatggagcatcaaatttctcataaaggacggcaaggtcagtgctacggtt |
14598695 |
T |
|
| Q |
118 |
aaccggtgaaatctttggaatttggtcaagtatccatgaaaagccgaaccatatctcacaggtaattgacatgagccata |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14598696 |
aaccggtgaaatctttggaatttggtcaagtatccatgaaaagccgaaccatatctcacaagtaattgacatgagccata |
14598775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 14609880 - 14609709
Alignment:
| Q |
18 |
caaagaggtcacaaccaggcagatcagatctccctgtgggattttctggggatggagcatcaaatttctcataaaggacggcaaggtcagtgctacggtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||| | | | | |||||||||| ||||||| | |||||||||||||| || |
|
|
| T |
14609880 |
caaagaggtcacaaccaggcagatcagatcttgctgtgggatttgtcggggttacaacgtggaatttctcatgaaggacgtctaggtcagtgctacgatt |
14609781 |
T |
|
| Q |
118 |
aaccggtgaaatctttggaatttggtcaagtatccatgaaaagccgaaccatatctcacaggtaattgacat |
189 |
Q |
| |
|
||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14609780 |
aactggagaaagctttggaatttggtcaagtatccatgaaaagccgaaccatatctcacaagtaattgacat |
14609709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University