View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12146_high_7 (Length: 409)
Name: NF12146_high_7
Description: NF12146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12146_high_7 |
 |  |
|
| [»] scaffold0198 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0198 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: scaffold0198
Description:
Target: scaffold0198; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 194 - 400
Target Start/End: Original strand, 6217 - 6419
Alignment:
| Q |
194 |
gggtacttttattgtatatcaatcaatcaattcctcatcatgcaacaactccaagtgcttctttgattctctgaatggtcactgagatttgtgcattgac |
293 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6217 |
gggtacttttattgtatatca----atcaattcctcatcatgcaacaactccaagtgcttctttgattctctgaatggtcactgagatttgtgcattgac |
6312 |
T |
 |
| Q |
294 |
agactcaactgactccattgtgagcttacttgttggagtgttgttcagcagcatttgtaatccaaatgtcagcaagcatccaccgttgtctccaccctcg |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6313 |
agactcaactgactccattgtgagcttacttgttggagtgttgttcagcagcatttgtaatccaaatgtcagcaagcatccaccgttgtctccgccctcg |
6412 |
T |
 |
| Q |
394 |
cctttgc |
400 |
Q |
| |
|
|| |||| |
|
|
| T |
6413 |
ccattgc |
6419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0198; HSP #2
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 17 - 135
Target Start/End: Original strand, 6041 - 6158
Alignment:
| Q |
17 |
attaattgctctttcatggttcgttcttgacttaattatgtctcagccttttccaactataatctaaaatcccctaatacatccaaaattgtatgtaaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6041 |
attaattgctctttcatggttcgttcttgacttaattatgtctcagccttttccaactataatctaaaatcccctaatacatcc-aaattgtatgtaaca |
6139 |
T |
 |
| Q |
117 |
tttttctatgcccaatttc |
135 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6140 |
tttttctatgcccaatttc |
6158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University