View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12146_low_23 (Length: 230)
Name: NF12146_low_23
Description: NF12146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12146_low_23 |
 | |
|
| [»] scaffold1678 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 22 - 212
Target Start/End: Complemental strand, 32303633 - 32303443
Alignment:
| Q |
22 |
tgagtcatgaacccaaggggattaacaaaacgaatcaaggaagggacacccatgttcttggtgaggacaatgctgtcagattcgttgtccataatctttg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32303633 |
tgagtcatgaacccaaggggattaacaaaacgaatcaaggaagggacacccatgttcttggtgaggacaatgctgtcagattcgttgtccataatctttg |
32303534 |
T |
|
| Q |
122 |
tacatgtgcccttcacattttcggctttcaccttgcaaacctcttcctcgtgatcacctttacattcaatgttgtagacaccatttttgtc |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32303533 |
tacatgcgcccttcacattttcggctttcaccttgcaaacctcttcctcgtgatcacctttacattcaatgttgtagacaccatttttgtc |
32303443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 25 - 198
Target Start/End: Complemental strand, 32295988 - 32295815
Alignment:
| Q |
25 |
gtcatgaacccaaggggattaacaaaacgaatcaaggaagggacacccatgttcttggtgaggacaatgctgtcagattcgttgtccataatctttgtac |
124 |
Q |
| |
|
|||||||| || |||| |||||||||||||| ||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||| |
|
|
| T |
32295988 |
gtcatgaatccgagggcattaacaaaacgaaccaaggaaggaacacccatgttcttggtgaggacaatcatgtcggattcgttgtccataatctttctac |
32295889 |
T |
|
| Q |
125 |
atgtgcccttcacattttcggctttcaccttgcaaacctcttcctcgtgatcacctttacattcaatgttgtag |
198 |
Q |
| |
|
| | ||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32295888 |
agtttcccttttcatttacggcgttcaccttgcaaacctcttcctcgtgatcacctttacattcaatgttgtag |
32295815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 36 - 212
Target Start/End: Original strand, 24429105 - 24429281
Alignment:
| Q |
36 |
aaggggattaacaaaacgaatcaaggaagggacacccatgttcttggtgaggacaatgctgtcagattcgttgtccataatctttgtacatgtgcccttc |
135 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||| |||||||||| ||||||| |||| |||| ||| ||||||| | ||||||||| ||||| |
|
|
| T |
24429105 |
aaggggattaacaatacgaaccaaggaatcacgacccacgttcttggtggggacaatcatgtcggatttgttctccataaaccctgtacatgtacccttt |
24429204 |
T |
|
| Q |
136 |
acattttcggctttcaccttgcaaacctcttcctcgtgatcacctttacattcaatgttgtagacaccatttttgtc |
212 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||||||||||||||||||| |||| |||||| ||||| |||||| |
|
|
| T |
24429205 |
gtattttcgggtttcaccatgcaaacgtcttcctcgtgatcacctttacatacaatcatgtagaaaccatctttgtc |
24429281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1678 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold1678
Description:
Target: scaffold1678; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 146 - 208
Target Start/End: Original strand, 490 - 552
Alignment:
| Q |
146 |
ctttcaccttgcaaacctcttcctcgtgatcacctttacattcaatgttgtagacaccatttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| | || || |||||||| |||||||| |
|
|
| T |
490 |
ctttcaccttgcaaacctcttcctcgtgagcaccttcaatttgaaagttgtagataccatttt |
552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University