View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12146_low_26 (Length: 212)
Name: NF12146_low_26
Description: NF12146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12146_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 6008177 - 6007994
Alignment:
| Q |
13 |
acctgtgctgtgcattaatgctagaatattaaagtaagaatgttccaatactctggaaatcaaattatttatgaactaaagttgtgtctatgaaaaagta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6008177 |
acctgtgctgtgcattaatgctagaatattaaagtcagaatgttccaatactctggaaatcaaattatttatgaactaaagttgtgtctatgaaaaagta |
6008078 |
T |
|
| Q |
113 |
catcagctagctaaaagaatattgcgtgtttcaaagttttgtaaacctgtgtatatatagattcaatttgatctcgttatatat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6008077 |
catcagctagctaaaagaatattgcgtgtttcaaagttttgtaaacctgtgtatatatagattcaatttgatctcgttatatat |
6007994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University