View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12147_low_2 (Length: 238)
Name: NF12147_low_2
Description: NF12147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12147_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 111 - 220
Target Start/End: Original strand, 6985653 - 6985762
Alignment:
| Q |
111 |
tttaccaggacgaagattttcagaaccagaattgatgaggttgatgagaccagcacgaccataaaacttagcaagaaaaagagtagcattagcttgtgat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6985653 |
tttaccaggacgaagattttcagaaccagaattgatgaggttgatgagaccagcacgaccataaaacttagcaagaaaaagagtagcattagcttgtgat |
6985752 |
T |
|
| Q |
211 |
tgaggacact |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
6985753 |
tgaggacact |
6985762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 71
Target Start/End: Original strand, 6985579 - 6985615
Alignment:
| Q |
35 |
tttgatgtccccacatagatcatagggacataatcta |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6985579 |
tttgatgtccccacatagatcatagggacataatcta |
6985615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University