View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12149_high_10 (Length: 239)
Name: NF12149_high_10
Description: NF12149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12149_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 49684352 - 49684132
Alignment:
| Q |
1 |
aaagctttggtgtctctggactatcttcttgagtgtatgcttactgtgtgtttcagaggttgtactattcatatttttggatgtggatttgaggatctga |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49684352 |
aaagcttttgtgtctctggactatcttcttgagtgtatgcttactgtgtgtttcagaggttgtactattcatatttttggatgtggatttgaggatctga |
49684253 |
T |
 |
| Q |
101 |
attcaaccagtatgaaatgttttacttgaattgaaaatttattgttattaccgtgggcattaacttcagtcctatttatatgagtttgtttcatacaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49684252 |
attcaaccagtatgaaatgttttacttgaattgaaaatttattgttattaccgtgggcattaacttcagtcctatttatatgagtttgtttcatacaatt |
49684153 |
T |
 |
| Q |
201 |
cttatttcttagtctgtttcc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49684152 |
cttatttcttagtctgtttcc |
49684132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 27 - 135
Target Start/End: Complemental strand, 49694574 - 49694466
Alignment:
| Q |
27 |
tcttgagtgtatgcttactgtgtgtttcagaggttgtactattcatatttttggatgtggatttgaggatctgaattcaaccagtatgaaatgttttact |
126 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||| ||||| |||||||||||||||||||||||||||||||||||||| ||| ||| ||||| | |
|
|
| T |
49694574 |
tcttgagtgtatgcttactgtgtgtttcggaggctgtatcattcacatttttggatgtggatttgaggatctgaattcaaccagaatggaatattttagt |
49694475 |
T |
 |
| Q |
127 |
tgaattgaa |
135 |
Q |
| |
|
|||| |||| |
|
|
| T |
49694474 |
tgaactgaa |
49694466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University