View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12150_high_4 (Length: 268)

Name: NF12150_high_4
Description: NF12150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12150_high_4
NF12150_high_4
[»] chr3 (14 HSPs)
chr3 (24-168)||(51104322-51104491)
chr3 (181-252)||(50823765-50823837)
chr3 (181-252)||(50852023-50852095)
chr3 (187-252)||(8400922-8400988)
chr3 (187-252)||(22855954-22856020)
chr3 (187-252)||(35198832-35198898)
chr3 (181-213)||(25910659-25910691)
chr3 (187-252)||(7417865-7417931)
chr3 (187-252)||(37330606-37330672)
chr3 (187-252)||(37454743-37454809)
chr3 (187-248)||(52545392-52545454)
chr3 (181-214)||(773683-773716)
chr3 (181-213)||(358935-358967)
chr3 (181-252)||(43334047-43334119)
[»] chr5 (1 HSPs)
chr5 (181-252)||(17064390-17064462)
[»] chr4 (11 HSPs)
chr4 (181-252)||(51713958-51714030)
chr4 (181-252)||(29576482-29576554)
chr4 (187-252)||(7173584-7173650)
chr4 (181-214)||(2570307-2570340)
chr4 (181-214)||(55231793-55231826)
chr4 (181-252)||(46494391-46494463)
chr4 (181-252)||(51066560-51066632)
chr4 (181-249)||(47626986-47627055)
chr4 (188-251)||(36192609-36192673)
chr4 (181-252)||(41523464-41523536)
chr4 (181-252)||(50905815-50905887)
[»] chr2 (12 HSPs)
chr2 (181-252)||(2754044-2754116)
chr2 (181-252)||(558432-558504)
chr2 (181-252)||(17136454-17136526)
chr2 (181-252)||(36380125-36380197)
chr2 (181-252)||(45136963-45137035)
chr2 (181-239)||(2357069-2357128)
chr2 (181-239)||(26690234-26690293)
chr2 (181-214)||(10745225-10745258)
chr2 (181-214)||(21638003-21638036)
chr2 (181-214)||(25987654-25987687)
chr2 (181-252)||(40156107-40156179)
chr2 (181-214)||(5039526-5039559)
[»] chr8 (14 HSPs)
chr8 (181-252)||(11404068-11404140)
chr8 (181-252)||(11909416-11909488)
chr8 (181-252)||(22711576-22711648)
chr8 (187-252)||(32296638-32296704)
chr8 (181-248)||(29767257-29767325)
chr8 (181-248)||(41553356-41553424)
chr8 (181-214)||(19723417-19723450)
chr8 (181-214)||(27879553-27879586)
chr8 (181-214)||(28019734-28019767)
chr8 (182-214)||(11610386-11610418)
chr8 (181-252)||(36261713-36261785)
chr8 (181-214)||(4840246-4840279)
chr8 (191-251)||(17095618-17095679)
chr8 (187-248)||(30682910-30682971)
[»] chr7 (9 HSPs)
chr7 (181-252)||(35109758-35109830)
chr7 (181-250)||(245257-245327)
chr7 (181-252)||(21577091-21577163)
chr7 (181-252)||(38265230-38265302)
chr7 (181-252)||(41151240-41151312)
chr7 (181-252)||(45278519-45278591)
chr7 (187-252)||(37095209-37095275)
chr7 (181-252)||(38405147-38405219)
chr7 (187-252)||(34721901-34721967)
[»] chr6 (3 HSPs)
chr6 (181-252)||(35163743-35163815)
chr6 (181-252)||(20685392-20685464)
chr6 (181-252)||(2711733-2711799)
[»] chr1 (11 HSPs)
chr1 (181-252)||(35618042-35618114)
chr1 (182-252)||(4573446-4573517)
chr1 (185-252)||(45324073-45324141)
chr1 (181-251)||(20014526-20014597)
chr1 (181-252)||(22024170-22024242)
chr1 (181-247)||(17015192-17015259)
chr1 (181-238)||(12025262-12025320)
chr1 (181-214)||(14498072-14498105)
chr1 (191-251)||(30054445-30054506)
chr1 (181-214)||(33762533-33762566)
chr1 (189-252)||(30370061-30370125)


Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 14)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 24 - 168
Target Start/End: Complemental strand, 51104491 - 51104322
Alignment:
24 ggggtgaccaatatagcaagttaaggatgaaaagtggaacaagataaagtac----ctagatgacagggaagaaagcagattggta------atgg---- 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||      ||||        
51104491 ggggtgaccaatatagcaagttaaggatgaaaagtggaacaagataaagtacctatctagatgacagggaagaaagcagattggtactgaacatggaaga 51104392  T
110 -----------tgatagaaggagaagtgtgagattgagattcgggattcactgattggtttttagagatc 168  Q
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51104391 cagtagccatatgatagaaggagaagtgtgagattgagattcgggattcactgattggtttttagagatc 51104322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 50823837 - 50823765
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
50823837 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 50823765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 50852023 - 50852095
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
50852023 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 50852095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 8400988 - 8400922
Alignment:
187 aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
8400988 aaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 8400922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 22856020 - 22855954
Alignment:
187 aaaattttagggtgaggggatggtgc-ccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    |||||||||||||||||||||||||| ||| | ||| ||| |||||||||| | |||||||||||||    
22856020 aaaattttagggtgaggggatggtgctccagtccaaggcagggaagacctttgggcttaaagagcac 22855954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 35198898 - 35198832
Alignment:
187 aaaattttagggtgaggggatggtgc-ccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    |||||||||||||||||||||||||| ||| | ||| ||| |||||||||||| ||| |||||||||    
35198898 aaaattttagggtgaggggatggtgctccagtccaaggcagggaagaccttcgggctcaaagagcac 35198832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 213
Target Start/End: Original strand, 25910659 - 25910691
Alignment:
181 gttacaaaaattttagggtgaggggatggtgcc 213  Q
    |||||||||||||||||||||||||||||||||    
25910659 gttacaaaaattttagggtgaggggatggtgcc 25910691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 7417931 - 7417865
Alignment:
187 aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||| |||| | ||| |||  ||||||||||| ||| |||||||||    
7417931 aaaattttagggtgaggggatggtgccccagtccaaggcagtgaagaccttcgggctcaaagagcac 7417865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 37330606 - 37330672
Alignment:
187 aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||| |||| | ||| ||| ||||||||||||  || |||||||||    
37330606 aaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcggactcaaagagcac 37330672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 37454743 - 37454809
Alignment:
187 aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||| ||||||  || | | |||||||||||| ||| |||||||||    
37454743 aaaattttagggtgaggggatggtgccccaatctaaggtagggaagaccttcgggctcaaagagcac 37454809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 52545454 - 52545392
Alignment:
187 aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaaga 248  Q
    ||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||    
52545454 aaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaaga 52545392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 773716 - 773683
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    |||||||||||| |||||||||||||||||||||    
773716 gttacaaaaattctagggtgaggggatggtgccc 773683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 213
Target Start/End: Original strand, 358935 - 358967
Alignment:
181 gttacaaaaattttagggtgaggggatggtgcc 213  Q
    |||||| ||||||||||||||||||||||||||    
358935 gttacataaattttagggtgaggggatggtgcc 358967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 43334047 - 43334119
Alignment:
181 gttacaaaaattttagggtgaggggatggt-gcccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||| ||||||||||||||||||||  |||| | ||| ||| |||||||||||| ||| ||| |||||    
43334047 gttacaaaatttttagggtgaggggatggtaccccagtccaaggcagggaagaccttcgggctcaaatagcac 43334119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 17064462 - 17064390
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| |||||||||||||    
17064462 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggcttaaagagcac 17064390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 11)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 51713958 - 51714030
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||||||| |||| | ||||||| |||||||||||| ||| |||||||||    
51713958 gttacaaaaattttagggtgaggggatggtgccccagttcaaagcagggaagaccttcgggctcaaagagcac 51714030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 29576554 - 29576482
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||| ||||| |||||| ||| ||| |||||||||||| ||| |||||||||    
29576554 gttacaaaaattttagggtgagggggtggtgccccaatccaaggcagggaagaccttcgggctcaaagagcac 29576482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 7173584 - 7173650
Alignment:
187 aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
7173584 aaaattttagggtgaggggatggtgccccagtccaacgcagggaagaccttcgggctcaaagagcac 7173650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 2570340 - 2570307
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    ||||||||||||||||||||||||||||||||||    
2570340 gttacaaaaattttagggtgaggggatggtgccc 2570307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 55231826 - 55231793
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    ||||||||||||||||||||||||||||||||||    
55231826 gttacaaaaattttagggtgaggggatggtgccc 55231793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 46494391 - 46494463
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||| ||||||||||||||||||||| |||| | ||| | | |||||||||||| ||| |||||||||    
46494391 gttacaaaatttttagggtgaggggatggtgccccagtccaaggtagggaagaccttcgggctcaaagagcac 46494463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 51066632 - 51066560
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||  ||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
51066632 gttacaaattttttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 51066560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 249
Target Start/End: Original strand, 47626986 - 47627055
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagag 249  Q
    ||||||||||||||||||||||| |||||||  ||| | ||| ||| |||||||||||||| | ||||||    
47626986 gttacaaaaattttagggtgaggagatggtgttccagtccaaggcagggaagaccttcgagttcaaagag 47627055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 188 - 251
Target Start/End: Complemental strand, 36192673 - 36192609
Alignment:
188 aaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagca 251  Q
    |||||||||||||||||||||||| |||| | ||| | | |||||||||||| ||| ||||||||    
36192673 aaattttagggtgaggggatggtgccccagtccaaggtagggaagaccttcgggctcaaagagca 36192609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 41523536 - 41523464
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||| ||||||| ||| ||||||||| |||||| |||   | |||||||||||||||| |||||||||    
41523536 gttacaaaatttttaggatgaagggatggtgtcccaatccaagatagggaagaccttcgagctcaaagagcac 41523464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 50905887 - 50905815
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    |||||||||||||||||||||  |||||||| |||| | ||| ||| ||||||||||||  || |||||||||    
50905887 gttacaaaaattttagggtgaaaggatggtgccccagttcaaggcatggaagaccttcggactcaaagagcac 50905815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 12)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 2754044 - 2754116
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||||||| |||||||||    
2754044 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgagctcaaagagcac 2754116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 558432 - 558504
Alignment:
181 gttacaaaaattttagggtgaggggatggtgcccaatgcaaagcaa-ggaagaccttcgagcttaaagagcac 252  Q
    |||||||||||||||||||||||||||||||||| || | ||| || ||||||||||| |||| |||||||||    
558432 gttacaaaaattttagggtgaggggatggtgccccattccaaggaagggaagaccttctagctcaaagagcac 558504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 17136526 - 17136454
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||  |||||||||||| ||| |||||||||    
17136526 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcggggaagaccttcgggctcaaagagcac 17136454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 36380125 - 36380197
Alignment:
181 gttacaaaaattttagggtgaggggatggtgcc-caatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||||||||| || | ||| | | |||||||||||| ||| |||||||||    
36380125 gttacaaaaattttagggtgaggggatggtgcctcagtccaaggtagggaagaccttcgggctcaaagagcac 36380197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 45136963 - 45137035
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||| ||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
45136963 gttacaaaaattttagggtgaagggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 45137035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 239
Target Start/End: Original strand, 2357069 - 2357128
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcga 239  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||||    
2357069 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcatggaagaccttcga 2357128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 239
Target Start/End: Complemental strand, 26690293 - 26690234
Alignment:
181 gttacaaaaattttagggtgaggggatggtgcc-caatgcaaagcaaggaagaccttcga 239  Q
    ||||||||||||||||||||||||||||||||| || | ||| ||| |||||||||||||    
26690293 gttacaaaaattttagggtgaggggatggtgcctcagtccaaggcagggaagaccttcga 26690234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 10745225 - 10745258
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    ||||||||||||||||||||||||||||||||||    
10745225 gttacaaaaattttagggtgaggggatggtgccc 10745258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 21638036 - 21638003
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    ||||||||||||||||||||||||||||||||||    
21638036 gttacaaaaattttagggtgaggggatggtgccc 21638003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 25987654 - 25987687
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    ||||||||||||||||||||||||||||||||||    
25987654 gttacaaaaattttagggtgaggggatggtgccc 25987687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 40156179 - 40156107
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||| ||||||||||||||| |||| | ||| | | |||||||||||| ||| |||||||||    
40156179 gttacaaaaattttatggtgaggggatggtgccccagttcaaggtagggaagaccttcgggctcaaagagcac 40156107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 5039559 - 5039526
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    |||||||||||||||| |||||||||||||||||    
5039559 gttacaaaaattttagagtgaggggatggtgccc 5039526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 14)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 11404140 - 11404068
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
11404140 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 11404068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 11909416 - 11909488
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||| ||||||||||||||||||||| |||| | ||| ||| |||||||||||||||| |||||||||    
11909416 gttacaaaatttttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgagctcaaagagcac 11909488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 22711648 - 22711576
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||| ||||||||||||| |||| | ||| |||||||||||||||| ||| |||||||||    
22711648 gttacaaaaattttaggatgaggggatggtgccccagtccaaggcaaggaagaccttcgggctcaaagagcac 22711576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 32296638 - 32296704
Alignment:
187 aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||| |||||| ||| ||| |||||||||||| ||| |||||||||    
32296638 aaaattttagggtgaggggatggtgccccaatccaaggcagggaagaccttcgggctcaaagagcac 32296704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 248
Target Start/End: Complemental strand, 29767325 - 29767257
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaaga 248  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||    
29767325 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaaga 29767257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 248
Target Start/End: Complemental strand, 41553424 - 41553356
Alignment:
181 gttacaaaaattttagggtgaggggatggtgc-ccaatgcaaagcaaggaagaccttcgagcttaaaga 248  Q
    |||||||||||||||||||||||||||||||| ||| |  || ||| |||||||||||||||| |||||    
41553424 gttacaaaaattttagggtgaggggatggtgctccagtctaaggcagggaagaccttcgagctcaaaga 41553356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 19723450 - 19723417
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    ||||||||||||||||||||||||||||||||||    
19723450 gttacaaaaattttagggtgaggggatggtgccc 19723417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 27879553 - 27879586
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    ||||||||||||||||||||||||||||||||||    
27879553 gttacaaaaattttagggtgaggggatggtgccc 27879586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 28019734 - 28019767
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    ||||||||||||||||||||||||||||||||||    
28019734 gttacaaaaattttagggtgaggggatggtgccc 28019767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 214
Target Start/End: Complemental strand, 11610418 - 11610386
Alignment:
182 ttacaaaaattttagggtgaggggatggtgccc 214  Q
    |||||||||||||||||||||||||||||||||    
11610418 ttacaaaaattttagggtgaggggatggtgccc 11610386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 36261785 - 36261713
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||| ||||||||||||||| |||| | ||| ||| |||||| ||||| ||| |||||||||    
36261785 gttacaaaaattttaaggtgaggggatggtgccccagttcaaggcagggaagatcttcgggctcaaagagcac 36261713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 4840279 - 4840246
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    |||||| |||||||||||||||||||||||||||    
4840279 gttacagaaattttagggtgaggggatggtgccc 4840246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 17095679 - 17095618
Alignment:
191 ttttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagca 251  Q
    ||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||    
17095679 ttttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagca 17095618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 30682971 - 30682910
Alignment:
187 aaaattttagggtgaggggatggtgcccaatgcaaagcaaggaagaccttcgagcttaaaga 248  Q
    ||||||||| ||||||||||||||||||| | ||| ||| |||||| ||||| ||| |||||    
30682971 aaaattttaaggtgaggggatggtgcccagtccaaggcagggaagatcttcgggctcaaaga 30682910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 9)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 35109830 - 35109758
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
35109830 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 35109758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 181 - 250
Target Start/End: Original strand, 245257 - 245327
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagc 250  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||    
245257 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagc 245327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 21577091 - 21577163
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||| ||||||||||||  || |||||||||    
21577091 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcggactcaaagagcac 21577163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 38265230 - 38265302
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    |||||| |||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
38265230 gttacataaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 38265302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 41151312 - 41151240
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    |||||||||| |||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
41151312 gttacaaaaaatttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 41151240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 45278591 - 45278519
Alignment:
181 gttacaaaaattttagggtgaggggatggtgc-ccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    |||||||||||||||||||||||||||||||| ||| | ||| ||| ||||||| |||| | |||||||||||    
45278591 gttacaaaaattttagggtgaggggatggtgctccagtccaaggcagggaagacattcgggtttaaagagcac 45278519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 37095209 - 37095275
Alignment:
187 aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
37095209 aaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 37095275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 38405147 - 38405219
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||| ||||||||||||||||||||| |||| | ||| ||| |||||||||||| | | |||||||||    
38405147 gttacaaaatttttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggttcaaagagcac 38405219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 34721967 - 34721901
Alignment:
187 aaaattttagggtgaggggatggtgccc-aatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    |||||||||||||||||||||||||||| | | ||| ||| ||||| |||||| ||| |||||||||    
34721967 aaaattttagggtgaggggatggtgcccgagtccaaggcagggaagtccttcgggctcaaagagcac 34721901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 35163743 - 35163815
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
35163743 gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 35163815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 20685464 - 20685392
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||| ||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
20685464 gttacaaaaattttagggtgaagggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 20685392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 2711733 - 2711799
Alignment:
181 gttacaaaaattttagggtgaggggatggtgcccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    |||||||||||||||||||||||||||||||     | ||| ||| |||||||||||||||| |||||||||    
2711733 gttacaaaaattttagggtgaggggatggtg-----tccaaggcagggaagaccttcgagctcaaagagcac 2711799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 11)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 35618114 - 35618042
Alignment:
181 gttacaaaaattttagggtgaggggatggtgcccaa-tgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||| |||||||||||||||||||| ||| | | |||||||||||||||||||| ||| |||||||||    
35618114 gttacaaaatttttagggtgaggggatggtaccccagtccaaagcaaggaagaccttcgggctcaaagagcac 35618042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 182 - 252
Target Start/End: Complemental strand, 4573517 - 4573446
Alignment:
182 ttacaaaaattttagggtgaggggatggtgcc-caatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    |||||||||||||||||||||||||| ||||| || | |||| || |||||||||||||||| |||||||||    
4573517 ttacaaaaattttagggtgaggggatagtgcctcagtccaaaacagggaagaccttcgagctcaaagagcac 4573446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 185 - 252
Target Start/End: Complemental strand, 45324141 - 45324073
Alignment:
185 caaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||||||||||||||||||||||| |||| | ||||||| |||||||||||| ||| || ||||||    
45324141 caaaaattttagggtgaggggatggtgccccagtccaaagcagggaagaccttcgggctcaaggagcac 45324073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 251
Target Start/End: Complemental strand, 20014597 - 20014526
Alignment:
181 gttacaaaaattttagggtgaggggatggtgcc-caatgcaaagcaaggaagaccttcgagcttaaagagca 251  Q
    ||||||||||||||||||||||||||||||||| || | ||| ||| |||||||||||  ||| ||||||||    
20014597 gttacaaaaattttagggtgaggggatggtgcctcagtccaaggcagggaagaccttcaggctcaaagagca 20014526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 22024242 - 22024170
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    |||||| |||||||||||||||||||||||| |||| | ||| |||  ||||||||||| ||| |||||||||    
22024242 gttacataaattttagggtgaggggatggtgccccagtccaaggcagagaagaccttcgggctcaaagagcac 22024170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 181 - 247
Target Start/End: Complemental strand, 17015259 - 17015192
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaag 247  Q
    |||||| |||||||||| ||||||||||||| |||| | ||||||| |||||||||||| ||| ||||    
17015259 gttacataaattttaggatgaggggatggtgccccagtccaaagcagggaagaccttcgggctcaaag 17015192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 238
Target Start/End: Complemental strand, 12025320 - 12025262
Alignment:
181 gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcg 238  Q
    ||||||||||||||||||||||||| ||||| |||| | ||| ||| ||||||||||||    
12025320 gttacaaaaattttagggtgagggggtggtgccccagtccaaggcagggaagaccttcg 12025262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 14498072 - 14498105
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    ||||||||||||||||||||||||||||| ||||    
14498072 gttacaaaaattttagggtgaggggatggcgccc 14498105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 30054445 - 30054506
Alignment:
191 ttttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagca 251  Q
    ||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||    
30054445 ttttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagca 30054506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 33762533 - 33762566
Alignment:
181 gttacaaaaattttagggtgaggggatggtgccc 214  Q
    |||||||||||||||||||||||||||| |||||    
33762533 gttacaaaaattttagggtgaggggatgatgccc 33762566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 252
Target Start/End: Original strand, 30370061 - 30370125
Alignment:
189 aattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac 252  Q
    ||||||| ||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||||    
30370061 aattttaaggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac 30370125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University