View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12150_low_4 (Length: 268)
Name: NF12150_low_4
Description: NF12150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12150_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 14)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 24 - 168
Target Start/End: Complemental strand, 51104491 - 51104322
Alignment:
| Q |
24 |
ggggtgaccaatatagcaagttaaggatgaaaagtggaacaagataaagtac----ctagatgacagggaagaaagcagattggta------atgg---- |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
51104491 |
ggggtgaccaatatagcaagttaaggatgaaaagtggaacaagataaagtacctatctagatgacagggaagaaagcagattggtactgaacatggaaga |
51104392 |
T |
 |
| Q |
110 |
-----------tgatagaaggagaagtgtgagattgagattcgggattcactgattggtttttagagatc |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51104391 |
cagtagccatatgatagaaggagaagtgtgagattgagattcgggattcactgattggtttttagagatc |
51104322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 50823837 - 50823765
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
50823837 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
50823765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 50852023 - 50852095
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
50852023 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
50852095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 8400988 - 8400922
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
8400988 |
aaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
8400922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 22856020 - 22855954
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtgc-ccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | ||| ||| |||||||||| | ||||||||||||| |
|
|
| T |
22856020 |
aaaattttagggtgaggggatggtgctccagtccaaggcagggaagacctttgggcttaaagagcac |
22855954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 35198898 - 35198832
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtgc-ccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
35198898 |
aaaattttagggtgaggggatggtgctccagtccaaggcagggaagaccttcgggctcaaagagcac |
35198832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 213
Target Start/End: Original strand, 25910659 - 25910691
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgcc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25910659 |
gttacaaaaattttagggtgaggggatggtgcc |
25910691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 7417931 - 7417865
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||| ||| ||||||||||| ||| ||||||||| |
|
|
| T |
7417931 |
aaaattttagggtgaggggatggtgccccagtccaaggcagtgaagaccttcgggctcaaagagcac |
7417865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 37330606 - 37330672
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| || ||||||||| |
|
|
| T |
37330606 |
aaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcggactcaaagagcac |
37330672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 37454743 - 37454809
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||| |||||| || | | |||||||||||| ||| ||||||||| |
|
|
| T |
37454743 |
aaaattttagggtgaggggatggtgccccaatctaaggtagggaagaccttcgggctcaaagagcac |
37454809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 52545454 - 52545392
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaaga |
248 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||| |
|
|
| T |
52545454 |
aaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaaga |
52545392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 773716 - 773683
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
773716 |
gttacaaaaattctagggtgaggggatggtgccc |
773683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 213
Target Start/End: Original strand, 358935 - 358967
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgcc |
213 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
358935 |
gttacataaattttagggtgaggggatggtgcc |
358967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 43334047 - 43334119
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggt-gcccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||| ||||| |
|
|
| T |
43334047 |
gttacaaaatttttagggtgaggggatggtaccccagtccaaggcagggaagaccttcgggctcaaatagcac |
43334119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 17064462 - 17064390
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
17064462 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggcttaaagagcac |
17064390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 11)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 51713958 - 51714030
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
51713958 |
gttacaaaaattttagggtgaggggatggtgccccagttcaaagcagggaagaccttcgggctcaaagagcac |
51714030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 29576554 - 29576482
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||| ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
29576554 |
gttacaaaaattttagggtgagggggtggtgccccaatccaaggcagggaagaccttcgggctcaaagagcac |
29576482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 7173584 - 7173650
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
7173584 |
aaaattttagggtgaggggatggtgccccagtccaacgcagggaagaccttcgggctcaaagagcac |
7173650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 2570340 - 2570307
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2570340 |
gttacaaaaattttagggtgaggggatggtgccc |
2570307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 55231826 - 55231793
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
55231826 |
gttacaaaaattttagggtgaggggatggtgccc |
55231793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 46494391 - 46494463
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||| | ||| | | |||||||||||| ||| ||||||||| |
|
|
| T |
46494391 |
gttacaaaatttttagggtgaggggatggtgccccagtccaaggtagggaagaccttcgggctcaaagagcac |
46494463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 51066632 - 51066560
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
51066632 |
gttacaaattttttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
51066560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 249
Target Start/End: Original strand, 47626986 - 47627055
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagag |
249 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||| | ||| ||| |||||||||||||| | |||||| |
|
|
| T |
47626986 |
gttacaaaaattttagggtgaggagatggtgttccagtccaaggcagggaagaccttcgagttcaaagag |
47627055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 188 - 251
Target Start/End: Complemental strand, 36192673 - 36192609
Alignment:
| Q |
188 |
aaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagca |
251 |
Q |
| |
|
|||||||||||||||||||||||| |||| | ||| | | |||||||||||| ||| |||||||| |
|
|
| T |
36192673 |
aaattttagggtgaggggatggtgccccagtccaaggtagggaagaccttcgggctcaaagagca |
36192609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 41523536 - 41523464
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||| ||||||| ||| ||||||||| |||||| ||| | |||||||||||||||| ||||||||| |
|
|
| T |
41523536 |
gttacaaaatttttaggatgaagggatggtgtcccaatccaagatagggaagaccttcgagctcaaagagcac |
41523464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 50905887 - 50905815
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||| | ||| ||| |||||||||||| || ||||||||| |
|
|
| T |
50905887 |
gttacaaaaattttagggtgaaaggatggtgccccagttcaaggcatggaagaccttcggactcaaagagcac |
50905815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 2754044 - 2754116
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
2754044 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgagctcaaagagcac |
2754116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 558432 - 558504
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgcccaatgcaaagcaa-ggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || | ||| || ||||||||||| |||| ||||||||| |
|
|
| T |
558432 |
gttacaaaaattttagggtgaggggatggtgccccattccaaggaagggaagaccttctagctcaaagagcac |
558504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 17136526 - 17136454
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| || |||||||||||| ||| ||||||||| |
|
|
| T |
17136526 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcggggaagaccttcgggctcaaagagcac |
17136454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 36380125 - 36380197
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgcc-caatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || | ||| | | |||||||||||| ||| ||||||||| |
|
|
| T |
36380125 |
gttacaaaaattttagggtgaggggatggtgcctcagtccaaggtagggaagaccttcgggctcaaagagcac |
36380197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 45136963 - 45137035
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
45136963 |
gttacaaaaattttagggtgaagggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
45137035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 239
Target Start/End: Original strand, 2357069 - 2357128
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcga |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| ||| ||||||||||||| |
|
|
| T |
2357069 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcatggaagaccttcga |
2357128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 239
Target Start/End: Complemental strand, 26690293 - 26690234
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgcc-caatgcaaagcaaggaagaccttcga |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || | ||| ||| ||||||||||||| |
|
|
| T |
26690293 |
gttacaaaaattttagggtgaggggatggtgcctcagtccaaggcagggaagaccttcga |
26690234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 10745225 - 10745258
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10745225 |
gttacaaaaattttagggtgaggggatggtgccc |
10745258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 21638036 - 21638003
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21638036 |
gttacaaaaattttagggtgaggggatggtgccc |
21638003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 25987654 - 25987687
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25987654 |
gttacaaaaattttagggtgaggggatggtgccc |
25987687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 40156179 - 40156107
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||| | ||| | | |||||||||||| ||| ||||||||| |
|
|
| T |
40156179 |
gttacaaaaattttatggtgaggggatggtgccccagttcaaggtagggaagaccttcgggctcaaagagcac |
40156107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 5039559 - 5039526
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
5039559 |
gttacaaaaattttagagtgaggggatggtgccc |
5039526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 14)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 11404140 - 11404068
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
11404140 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
11404068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 11909416 - 11909488
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||| | ||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
11909416 |
gttacaaaatttttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgagctcaaagagcac |
11909488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 22711648 - 22711576
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||| | ||| |||||||||||||||| ||| ||||||||| |
|
|
| T |
22711648 |
gttacaaaaattttaggatgaggggatggtgccccagtccaaggcaaggaagaccttcgggctcaaagagcac |
22711576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 32296638 - 32296704
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
32296638 |
aaaattttagggtgaggggatggtgccccaatccaaggcagggaagaccttcgggctcaaagagcac |
32296704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 248
Target Start/End: Complemental strand, 29767325 - 29767257
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaaga |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||| |
|
|
| T |
29767325 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaaga |
29767257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 248
Target Start/End: Complemental strand, 41553424 - 41553356
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgc-ccaatgcaaagcaaggaagaccttcgagcttaaaga |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| | || ||| |||||||||||||||| ||||| |
|
|
| T |
41553424 |
gttacaaaaattttagggtgaggggatggtgctccagtctaaggcagggaagaccttcgagctcaaaga |
41553356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 19723450 - 19723417
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19723450 |
gttacaaaaattttagggtgaggggatggtgccc |
19723417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 27879553 - 27879586
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27879553 |
gttacaaaaattttagggtgaggggatggtgccc |
27879586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 28019734 - 28019767
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28019734 |
gttacaaaaattttagggtgaggggatggtgccc |
28019767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 214
Target Start/End: Complemental strand, 11610418 - 11610386
Alignment:
| Q |
182 |
ttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11610418 |
ttacaaaaattttagggtgaggggatggtgccc |
11610386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 36261785 - 36261713
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||| | ||| ||| |||||| ||||| ||| ||||||||| |
|
|
| T |
36261785 |
gttacaaaaattttaaggtgaggggatggtgccccagttcaaggcagggaagatcttcgggctcaaagagcac |
36261713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 4840279 - 4840246
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
4840279 |
gttacagaaattttagggtgaggggatggtgccc |
4840246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 17095679 - 17095618
Alignment:
| Q |
191 |
ttttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagca |
251 |
Q |
| |
|
||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||| |
|
|
| T |
17095679 |
ttttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagca |
17095618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 30682971 - 30682910
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtgcccaatgcaaagcaaggaagaccttcgagcttaaaga |
248 |
Q |
| |
|
||||||||| ||||||||||||||||||| | ||| ||| |||||| ||||| ||| ||||| |
|
|
| T |
30682971 |
aaaattttaaggtgaggggatggtgcccagtccaaggcagggaagatcttcgggctcaaaga |
30682910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 35109830 - 35109758
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
35109830 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
35109758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 181 - 250
Target Start/End: Original strand, 245257 - 245327
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||| |
|
|
| T |
245257 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagc |
245327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 21577091 - 21577163
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| || ||||||||| |
|
|
| T |
21577091 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcggactcaaagagcac |
21577163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 38265230 - 38265302
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
38265230 |
gttacataaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
38265302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 41151312 - 41151240
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
41151312 |
gttacaaaaaatttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
41151240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 45278591 - 45278519
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgc-ccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| | ||| ||| ||||||| |||| | ||||||||||| |
|
|
| T |
45278591 |
gttacaaaaattttagggtgaggggatggtgctccagtccaaggcagggaagacattcgggtttaaagagcac |
45278519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 37095209 - 37095275
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
37095209 |
aaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
37095275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 38405147 - 38405219
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||| | ||| ||| |||||||||||| | | ||||||||| |
|
|
| T |
38405147 |
gttacaaaatttttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggttcaaagagcac |
38405219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 34721967 - 34721901
Alignment:
| Q |
187 |
aaaattttagggtgaggggatggtgccc-aatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| | | ||| ||| ||||| |||||| ||| ||||||||| |
|
|
| T |
34721967 |
aaaattttagggtgaggggatggtgcccgagtccaaggcagggaagtccttcgggctcaaagagcac |
34721901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 35163743 - 35163815
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
35163743 |
gttacaaaaattttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
35163815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 20685464 - 20685392
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
20685464 |
gttacaaaaattttagggtgaagggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
20685392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Original strand, 2711733 - 2711799
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgcccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
2711733 |
gttacaaaaattttagggtgaggggatggtg-----tccaaggcagggaagaccttcgagctcaaagagcac |
2711799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 11)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 35618114 - 35618042
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgcccaa-tgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| | | |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
35618114 |
gttacaaaatttttagggtgaggggatggtaccccagtccaaagcaaggaagaccttcgggctcaaagagcac |
35618042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 182 - 252
Target Start/End: Complemental strand, 4573517 - 4573446
Alignment:
| Q |
182 |
ttacaaaaattttagggtgaggggatggtgcc-caatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| || | |||| || |||||||||||||||| ||||||||| |
|
|
| T |
4573517 |
ttacaaaaattttagggtgaggggatagtgcctcagtccaaaacagggaagaccttcgagctcaaagagcac |
4573446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 185 - 252
Target Start/End: Complemental strand, 45324141 - 45324073
Alignment:
| Q |
185 |
caaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||| |||| | ||||||| |||||||||||| ||| || |||||| |
|
|
| T |
45324141 |
caaaaattttagggtgaggggatggtgccccagtccaaagcagggaagaccttcgggctcaaggagcac |
45324073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 251
Target Start/End: Complemental strand, 20014597 - 20014526
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgcc-caatgcaaagcaaggaagaccttcgagcttaaagagca |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || | ||| ||| ||||||||||| ||| |||||||| |
|
|
| T |
20014597 |
gttacaaaaattttagggtgaggggatggtgcctcagtccaaggcagggaagaccttcaggctcaaagagca |
20014526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 22024242 - 22024170
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||| | ||| ||| ||||||||||| ||| ||||||||| |
|
|
| T |
22024242 |
gttacataaattttagggtgaggggatggtgccccagtccaaggcagagaagaccttcgggctcaaagagcac |
22024170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 181 - 247
Target Start/End: Complemental strand, 17015259 - 17015192
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaag |
247 |
Q |
| |
|
|||||| |||||||||| ||||||||||||| |||| | ||||||| |||||||||||| ||| |||| |
|
|
| T |
17015259 |
gttacataaattttaggatgaggggatggtgccccagtccaaagcagggaagaccttcgggctcaaag |
17015192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 238
Target Start/End: Complemental strand, 12025320 - 12025262
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcg |
238 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||| | ||| ||| |||||||||||| |
|
|
| T |
12025320 |
gttacaaaaattttagggtgagggggtggtgccccagtccaaggcagggaagaccttcg |
12025262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 14498072 - 14498105
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
14498072 |
gttacaaaaattttagggtgaggggatggcgccc |
14498105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 30054445 - 30054506
Alignment:
| Q |
191 |
ttttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagca |
251 |
Q |
| |
|
||||||||||||||||||||| |||| | ||| ||| |||||||||||| ||| |||||||| |
|
|
| T |
30054445 |
ttttagggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagca |
30054506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 33762533 - 33762566
Alignment:
| Q |
181 |
gttacaaaaattttagggtgaggggatggtgccc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
33762533 |
gttacaaaaattttagggtgaggggatgatgccc |
33762566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 252
Target Start/End: Original strand, 30370061 - 30370125
Alignment:
| Q |
189 |
aattttagggtgaggggatggtg-cccaatgcaaagcaaggaagaccttcgagcttaaagagcac |
252 |
Q |
| |
|
||||||| ||||||||||||||| |||| | ||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
30370061 |
aattttaaggtgaggggatggtgccccagtccaaggcagggaagaccttcgggctcaaagagcac |
30370125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University