View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12150_low_5 (Length: 205)
Name: NF12150_low_5
Description: NF12150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12150_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 10 - 188
Target Start/End: Original strand, 41630015 - 41630193
Alignment:
| Q |
10 |
agaacctgtgagttcagtttctgatacttcacctgaagaagatgttgctatgtgtctcatgatgctttcgagggacaaatggagtcgaaagatgaacaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41630015 |
agaacctgtgagttcagtttctgatacttcacctgaagaagatgttgctatgtgtctcatgatgctttcgagggacaaatggagtcgaaagatgaacaac |
41630114 |
T |
 |
| Q |
110 |
gacaacaatgtggaacaagaagaagatgagggatcggtggagaaaatatcgaaggtgaagttattgaaacgagttcgtg |
188 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41630115 |
gtcaacaatgtggaacaagaagaagatgagggatcggtggagaaaatatcgaaggtgaagttattgaaacgagttcgtg |
41630193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University