View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12151_high_4 (Length: 266)
Name: NF12151_high_4
Description: NF12151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12151_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 13 - 254
Target Start/End: Original strand, 17780840 - 17781081
Alignment:
| Q |
13 |
ctgtgatctgcaattgacttcacttgcttccaattccattaacgtgtctgttgtacactagaatctaaattaatggtcacattgagaatgtgattgtgta |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17780840 |
ctgtgatctgcaattgacttcactggcttccaattccattaacgtgtctgttgtacactagaatctaaattaatggtcacattgagaatgtgattgtgta |
17780939 |
T |
|
| Q |
113 |
atcccacgctgatgccttttttgactttctctttgcaggtaaagaagcatatcaagcaaggacaaggccatgaaggtggaatctttactgttgaagcccc |
212 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17780940 |
atcccatgctgatgccttttttgactttctctttgcaggtaaagaagcatatcaagcaaggacaaggccatgaaggtggaatctttactgttgaagcccc |
17781039 |
T |
|
| Q |
213 |
aatccatgcctcaaatgtgcaagttcttgatccagtcacagg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17781040 |
aatccatgcctcaaatgtgcaagttcttgatccagtcacagg |
17781081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University