View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12154_high_1 (Length: 462)
Name: NF12154_high_1
Description: NF12154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12154_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 188 - 453
Target Start/End: Original strand, 4885073 - 4885338
Alignment:
| Q |
188 |
atattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattatttttatccggtggtggcggtgtagggagaggcat |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4885073 |
atattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattatttttatccggtggtggcggcgtagggagaggcat |
4885172 |
T |
|
| Q |
288 |
gaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttaggaacaactccgccatcttgtgttgaaggtgaagaaggtttc |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4885173 |
gaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttaggaacaacaccgccatcttgtgttgaaggtgaagaaggtttc |
4885272 |
T |
|
| Q |
388 |
ttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatttcttct |
453 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885273 |
ttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatttcttct |
4885338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 18 - 128
Target Start/End: Original strand, 4884903 - 4885013
Alignment:
| Q |
18 |
caaatgaggtctccacacagcaacacgtcctcttcttctatctctctgactacaaaccttctcagacagaatctcagtcaagtactgatcagaagacaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4884903 |
caaatgaggtctccacacagcaacacgtcctcttcttctgtctctctgactacaaaccttctcagacagaatctcagtcaagtactgatcagaagaaaca |
4885002 |
T |
|
| Q |
118 |
accaacgtagc |
128 |
Q |
| |
|
||||||||||| |
|
|
| T |
4885003 |
accaacgtagc |
4885013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University