View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12155_high_5 (Length: 347)
Name: NF12155_high_5
Description: NF12155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12155_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 19 - 335
Target Start/End: Complemental strand, 47535346 - 47535030
Alignment:
| Q |
19 |
ataaagaatgaagggttagaaaagttaccccagaaaacatatgagtactaacagggcaaccacgatcaaccaagcaataatcaaactgacccaaagcagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47535346 |
ataaagaatgaagggttagaaaagttaccccagaaaacatatgagtactaacagggcaaccacgatcaaccaagcaataatcaaactgacccaaagcagc |
47535247 |
T |
 |
| Q |
119 |
attaacacagtgttcagcggtccaaccggttccatcagagacaatatatatggacttagccctaaactctgacccgtcttcactgacagtgtcatccggg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47535246 |
attaacacagtgttcagcggtccaaccggttccatcagagacaatatatatggacttagccctaaactctgacccgtcttcactgacagtgtcatccggg |
47535147 |
T |
 |
| Q |
219 |
tcgaccgcgaagaggactgtaggttgagagttgttgggttctatggtttgagttcgtggactagaccggtccaattttcgaccggaacgtattgcacgag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47535146 |
tcgaccgcgaagaggactgtaggttgagagttgttgggttctatggtttgagttcgtggactagaccggtccaattttcgaccggaacgtattgcacgag |
47535047 |
T |
 |
| Q |
319 |
ccctggaccacaggttc |
335 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
47535046 |
ccctggaccaccggttc |
47535030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University