View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12155_high_6 (Length: 245)
Name: NF12155_high_6
Description: NF12155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12155_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 30389137 - 30389346
Alignment:
| Q |
20 |
gaccggagtctgatgtctggtcattaggatgtactgtgattgagattttcaccggaaaatcgccgtgggaggatcggggattcgagacactgagtcgaat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30389137 |
gaccggagtctgatgtctggtcattaggatgtactgtaattgagattttcaccggaaaatcaccgtgggaggatcggggattcgagacgttgagtcgaat |
30389236 |
T |
|
| Q |
120 |
tggattttccgatgaggtaccggagtttccgagcggtttatcggaggtcgggagagattttcttgagaagtgtttgaggcgtgatcggaatcggagatgg |
219 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||| |||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30389237 |
tggattttccgatgagttaccggagtttccaagcggtttgtcggagctcgggagagattttctggagaaatgtttgaggcgtgatcggaatcggagatgg |
30389336 |
T |
|
| Q |
220 |
aggtgtgatc |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
30389337 |
aggtgtgatc |
30389346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University