View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12156_high_3 (Length: 220)
Name: NF12156_high_3
Description: NF12156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12156_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 121 - 209
Target Start/End: Complemental strand, 1977551 - 1977463
Alignment:
| Q |
121 |
atatctatagggactcatgtacaatagtttacacattagaaacagtaacttgtaactcatcaaatgaccttttaagttggtattagagc |
209 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1977551 |
atatcaatagggactcatgtacaatagtttacacattagaaacagtaacttgtaactcatcaaatgaccttttaagttggtattagagc |
1977463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 1977657 - 1977615
Alignment:
| Q |
15 |
agaaagatctattatgggttggtacttccattctacgctagat |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1977657 |
agaaagatctattatgggttggtacttccattctacgctagat |
1977615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University