View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12157_low_2 (Length: 296)
Name: NF12157_low_2
Description: NF12157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12157_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 23 - 159
Target Start/End: Original strand, 44043039 - 44043175
Alignment:
| Q |
23 |
tctctctctgaaactcttagatttcgtttttcttcaatcaggtaatcaatcaaccatggtgctcttcaatgtctcccgtattgaaactactcctttcgat |
122 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44043039 |
tctctctctgaaacttttagatttcgtttttcttcaatcaggtaatcaatcaaccatggtgctcttcaatgtctcccgtattgaaactactcctttcgat |
44043138 |
T |
|
| Q |
123 |
ggacagaagcctggaacctctggtctccgcaaaaagg |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44043139 |
ggacagaagcctggaacctctggtctccgcaaaaagg |
44043175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 296
Target Start/End: Original strand, 44043276 - 44043310
Alignment:
| Q |
262 |
atgattgtattatattactggatcgtatttcaaat |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
44043276 |
atgattgtattatattactggatcgtatttgaaat |
44043310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University