View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12158_high_3 (Length: 343)
Name: NF12158_high_3
Description: NF12158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12158_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 330
Target Start/End: Original strand, 3225753 - 3225860
Alignment:
| Q |
224 |
gaattattgttgcaatttaatcgtatagagtttttgtttcttcaacnnnnnnn-tacaaagttattgttatgacctgtttaatcattttttagggtgttg |
322 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225753 |
gaattattgttgcaatttaatcatatagagtttttgtttcttcaacaaaaaaaatacagagttattgttatgacctgtttaatcattttttagggtgttg |
3225852 |
T |
 |
| Q |
323 |
ggttatat |
330 |
Q |
| |
|
|||||||| |
|
|
| T |
3225853 |
ggttatat |
3225860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University