View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12158_high_4 (Length: 342)
Name: NF12158_high_4
Description: NF12158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12158_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 88 - 323
Target Start/End: Complemental strand, 38072219 - 38071984
Alignment:
| Q |
88 |
taataacaaaatcgataattagtggtaaacaaaacactagagaaaggtttaaggtaagagttatgatgtcgactctttgaagcaaaaatcaattaagata |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38072219 |
taataacaaaatcgataattagtggtaaacaaaacactagagaaaggtttaaggtaagagttatgatgtcgactctttgaagcaaaaatcaattaagata |
38072120 |
T |
 |
| Q |
188 |
agaacaaaagtaaaatcaacatccaccacaatcaagttggccacagaaaggagaagattaacaacaccacggtccacgggcatcgatttatgctttttac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38072119 |
agaacaaaagtaaaatcaacatccaccacaatcaagttggccacagaaaggagaagattaacaacaccacggtccacgggcatcgatttatgctttttac |
38072020 |
T |
 |
| Q |
288 |
taaattgacgtttatatcatcatttttcttcactac |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38072019 |
taaattgacgtttatatcatcatttttcttctctac |
38071984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University