View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12159_high_11 (Length: 241)
Name: NF12159_high_11
Description: NF12159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12159_high_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 31979959 - 31979749
Alignment:
| Q |
19 |
atatgtttctgaacaacatgaacaaggtggtttctttcatcatcatcaacatcattacccttattggcaacaaatggaacctatacagtttcaaacacca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31979959 |
atatgtttctgaacaacatgaacaaggtggtttctttcatcat------------tacccttattggcaacaaatggaacctatacagtttcaaacacca |
31979872 |
T |
 |
| Q |
119 |
caacaacatcatgttgaagcagcaacaaacacttttcatcctatggttccttgcaatggttatgcttctggttttggtgcttcatcttcaactcctcact |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31979871 |
caacaacatcatgttgaagcagcaacaaacacttttcatcctatggttccttgcaatggttatgcttctggttttggtgcttcatcttccactcctcact |
31979772 |
T |
 |
| Q |
219 |
atgtcttctccaacaatgctgct |
241 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
31979771 |
atgttttctccaacaatgctgct |
31979749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University