View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12159_high_16 (Length: 224)
Name: NF12159_high_16
Description: NF12159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12159_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 17988067 - 17988251
Alignment:
| Q |
18 |
tggagtatattaggaaggatatggaaggtagtgatcttgatacacggaggaggattgcttgcgatctgcttaaggggattgccatgcattatggacatac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17988067 |
tggagtatattaggaaggatatggaaggtagcgatcttgatacacggaggaggattgcttgcgatctgcttaaggggattgccatgcattatggacatgc |
17988166 |
T |
 |
| Q |
118 |
tgtatgacagcttgtttctacgcaaatacagagtttgttaagttcctttgctgaaaacccggtgaagaattggaggcacaaggat |
202 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17988167 |
tgtaagacagattgtttctacgcaaatacagagtttgttaagttcctttgctgaaaacccggtgaagaattggaggcacaaggat |
17988251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 9752438 - 9752256
Alignment:
| Q |
20 |
gagtatattaggaaggatatggaaggtagtgatcttgatacacggaggaggattgcttgcgatctgcttaaggggattgccatgcattatggacatactg |
119 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||| ||||| | || ||||||| || ||| |
|
|
| T |
9752438 |
gagtatattaggagggatatggaaggtagtgatcttgatacgcggaggaggattgcttgtgagttgcttaagggtattgctacgcgttatggagatgctg |
9752339 |
T |
 |
| Q |
120 |
tatgacagc-ttgtttctacgcaaatacagagtttgttaagttcctttgctgaaaacccggtgaagaattggaggcacaaggat |
202 |
Q |
| |
|
|| || ||| |||||||| ||||| ||||||||||||| || || ||| || ||| |||||| |||||||| | |||||||| |
|
|
| T |
9752338 |
taaga-agcattgtttctgcgcaagtacagagtttgttgagctcttttaatgcaaatccggtggcgaattggaaggacaaggat |
9752256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University