View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12159_low_12 (Length: 287)
Name: NF12159_low_12
Description: NF12159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12159_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 35654960 - 35655231
Alignment:
| Q |
1 |
tctggattggctggatccttttgattctcataacaataaaaggaattgatattggagtttttatatgtgatggaagccacaatcataagatatt---att |
97 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
35654960 |
tctgtattggctggatccttttgattctcataacaataaaaggaattgatattggagtttttatttgtgatggaagccacaatcataagatatttttatt |
35655059 |
T |
 |
| Q |
98 |
attattgttacacatctatcaaattcaacctcttaaaaatcaaattattttagcttatcaaattagaaaaagggaattggtaatcaacttaagtccttgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
35655060 |
attattgttacacatctatcaaattcaacctgttaaaaatcaaattattttagcttatcaaattagaaaaagggaattggcaatcaactttagtccttgt |
35655159 |
T |
 |
| Q |
198 |
ggtataaatattttttattacacgacagaaataatgcacttgcggcctatcaaagaaatataataattcact |
269 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
35655160 |
ggtataaatattttttattacacgaaagaaataatgcacttgcgccctatcaaagaaagataataattcact |
35655231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University