View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12159_low_19 (Length: 230)
Name: NF12159_low_19
Description: NF12159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12159_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 6 - 110
Target Start/End: Original strand, 31983701 - 31983805
Alignment:
| Q |
6 |
agtactcacaaaaatgatcaacacactttataactaaaggttttaccacctctggacaatcatctttagaaacgcatggaatgttagctgcgttttcaaa |
105 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||| ||||| ||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
31983701 |
agtactcacaaaaatgatcaatacactttataactaaaggtgttatcacctttggacaatcatctttagaaacacatggaatgttagctgcattttcaaa |
31983800 |
T |
 |
| Q |
106 |
attag |
110 |
Q |
| |
|
||||| |
|
|
| T |
31983801 |
attag |
31983805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 6 - 110
Target Start/End: Original strand, 31986336 - 31986440
Alignment:
| Q |
6 |
agtactcacaaaaatgatcaacacactttataactaaaggttttaccacctctggacaatcatctttagaaacgcatggaatgttagctgcgttttcaaa |
105 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
31986336 |
agtactcacaaaaatgatcaatacactttataactaaaggttttacaacctttggacaatcatctttagaaacacatggaatgttagctgcattttcaag |
31986435 |
T |
 |
| Q |
106 |
attag |
110 |
Q |
| |
|
||||| |
|
|
| T |
31986436 |
attag |
31986440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 31983881 - 31983929
Alignment:
| Q |
182 |
aaaaatggtatacttatttccgcctttttaacaagaaactgagaaagaa |
230 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31983881 |
aaaaatggcatacttatttccgcctttttaacaagaaactgagaaagaa |
31983929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 219
Target Start/End: Original strand, 31986515 - 31986552
Alignment:
| Q |
182 |
aaaaatggtatacttatttccgcctttttaacaagaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31986515 |
aaaaatggtatacttatttccgccttttcaacaagaaa |
31986552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University