View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12159_low_21 (Length: 203)
Name: NF12159_low_21
Description: NF12159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12159_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 19 - 183
Target Start/End: Complemental strand, 25870041 - 25869882
Alignment:
| Q |
19 |
tttagtatgtctctggtgttttgttttaaaaccattttttatatgaagtattgaacagtctcactacattccttgtttctctctctcnnnnnnnnnnnaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | || |
|
|
| T |
25870041 |
tttagtatgtctctggtgttttgttttaaaaccattttttatatgaagtattgaacagtctcactacattccttgtttctcttttt-----tttttttaa |
25869947 |
T |
|
| Q |
119 |
ttctgtacatgaggacaccttcccattgtaatttctttctctctgaaagtatttcttttcatgtt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25869946 |
ttctgtacatgaggacaccttcccattgtaatttctttctctctgaaagtatttcttttcatgtt |
25869882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University