View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12160_high_11 (Length: 297)
Name: NF12160_high_11
Description: NF12160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12160_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 20 - 279
Target Start/End: Original strand, 28842049 - 28842308
Alignment:
| Q |
20 |
accaatgtactcataacacaagaacttgatggttgcatcgctgatgttggacttactccccttatgaacaccttatcaaccatgtcaagatccaacggat |
119 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28842049 |
accaatgtactcgtaacacaagaacttgatggttgcatcgctgatgttggacttactccccttatgaacaccttatcaaccatgtcaagatccaatggat |
28842148 |
T |
 |
| Q |
120 |
accgtgcaccagaaataaccgaatcaaggaagatcgccactcagaagagtgatgtttacagctttggtataatccttcttgaaatgcttacagggaagat |
219 |
Q |
| |
|
||||||| |||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28842149 |
accgtgctccagaagtgatcgaatcaaggaagatcgccactcagaagagtgatgtttacagctttggtgtaatccttcttgaaatgcttacagggaagat |
28842248 |
T |
 |
| Q |
220 |
tccgttaggatattctggttatgatcatgacatggttgatcttccaagttgggttaggtc |
279 |
Q |
| |
|
||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28842249 |
tccattaggatattctggttatgagcatgacatggttgatcttccaaggtgggttaggtc |
28842308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University