View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12160_high_4 (Length: 481)
Name: NF12160_high_4
Description: NF12160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12160_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-116
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 41969453 - 41969222
Alignment:
| Q |
18 |
gatctttcatcactaaaatagagccaccctttcatagattcagttcaagtagaaatgctataaatacgtaactcaacgtttcttcataatcacaattcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41969453 |
gatctttcatcactaaaatagagccaccctttcatagattcagttcaagtagaaatgctataaatacgtaactcaacgtttcttcataatcacaattcac |
41969354 |
T |
 |
| Q |
118 |
ataacttttttgcgtttcgtaaagctttgagtaatggcaaaaaattataacatcaatatgctcttcttagttgtgttgtttcttcttgtacagagcaagg |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41969353 |
ataacttttttgcttttcgtaaagctttgagtaatggcaaaaaattataacatcaatatgctcttcttagttg---tgtttcttcttgtacagagcaagg |
41969257 |
T |
 |
| Q |
218 |
taaatcgacatattattatgctatgcatatttatc |
252 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41969256 |
taaatcgacatattattatgctatgaatatttatc |
41969222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 289 - 474
Target Start/End: Complemental strand, 41969181 - 41968996
Alignment:
| Q |
289 |
accttcgtccataattttatttttggatataagtttttcctttaaatatgtgaatcacaagtataatatttataaacttgatcaagggttttccgcgatt |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41969181 |
accttcgtccataattttatttttggatataagtttttcctttaaatatgtgaatcacaagtataatatttataaacttgatcaagggttttccgcgatt |
41969082 |
T |
 |
| Q |
389 |
tcgattgttatggatgctgccaaaacattgcacaattaccctcaccatttactcccactcacctcactttattcgtcacaggttct |
474 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
41969081 |
tcgattgttaccggtgctgccaaaacattgcacaattaccctcaccatttactcccactcacctcactttattcgttataggttct |
41968996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 1236516 - 1236272
Alignment:
| Q |
18 |
gatctttcatcactaaaatagagccaccctttcatagattcagttcaagtagaa-atgctataaatacgtaactcaac---gtttcttcataatcacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1236516 |
gatctttcatcactaaaatagagcca-cctttcatagattcagttcatgtagaatttgctataaatacgtaactcaacaattcttcttcataatcacaat |
1236418 |
T |
 |
| Q |
114 |
tcacataacttttttgcgtttcgtaaagctttgagtaatggcaaaaaattataacatcaatatgctcttcttagttgtgttgtttcttcttgtacagagc |
213 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
1236417 |
tcacataacttttttgcttttagtaaagctttgagtaatggcaaaaaattataacatcaatatgctcttcttagttg---tgtttcttcttgtacaaagc |
1236321 |
T |
 |
| Q |
214 |
aaggtaaatcgacat---------attattatgctatgcatatttatct |
253 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||||||| |
|
|
| T |
1236320 |
aaggtatattgacatacttctctcattattatgctatgcatatttatct |
1236272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 289 - 375
Target Start/End: Complemental strand, 1236237 - 1236150
Alignment:
| Q |
289 |
accttcgtccataattttatttttggatataagttttt-cctttaaatatgtgaatcacaagtataatatttataaacttgatcaagg |
375 |
Q |
| |
|
||||||||| ||||||||||||||| |||||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
1236237 |
accttcgtctataattttatttttgtatataaattttttcctttaaacatgtgaatcacaagtataatatttattaacttgatgaagg |
1236150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 409 - 462
Target Start/End: Original strand, 3722450 - 3722503
Alignment:
| Q |
409 |
caaaacattgcacaattaccctcaccatttactcccactcacctcactttattc |
462 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||| |||||| |
|
|
| T |
3722450 |
caaaacattgcacaattaccctcaccatttcctctcactcacctcacattattc |
3722503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 461
Target Start/End: Original strand, 7805573 - 7805618
Alignment:
| Q |
416 |
ttgcacaattaccctcaccatttactcccactcacctcactttatt |
461 |
Q |
| |
|
|||||||||||||||||||| || ||| ||||||||||||||||| |
|
|
| T |
7805573 |
ttgcacaattaccctcaccactttctctaactcacctcactttatt |
7805618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University