View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12160_low_20 (Length: 254)
Name: NF12160_low_20
Description: NF12160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12160_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 238
Target Start/End: Original strand, 6546392 - 6546615
Alignment:
| Q |
15 |
tgtgctacaatatgttgttgatcaaagaaaaagcaatatgctatgaagccaatgaagagctaaggttgaggatttaaggacaagagcaaaaatcagtgac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6546392 |
tgtgctacaatatgttgttgatcaaagaaaaagcaatatgctatgaagccaatgaagagctaaggttgaggatttaaggacaagagcaaaaatcagtgac |
6546491 |
T |
|
| Q |
115 |
atataagttttgtctcctatattcctgnnnnnnngctactttatttttattcctgcacaattattgtctaattttgatgaacatgtattgttacatagta |
214 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6546492 |
atataagttttgtctcctatattcctgtttttttgctcctttatttttattcctgcacaattattgtctaattttgatgaacatgtattgttacatagta |
6546591 |
T |
|
| Q |
215 |
tacaactgtaaaatatcaatgatt |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6546592 |
tacaactgtaaaatatcaatgatt |
6546615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University