View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12161_high_3 (Length: 286)
Name: NF12161_high_3
Description: NF12161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12161_high_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 3 - 286
Target Start/End: Original strand, 37120528 - 37120812
Alignment:
| Q |
3 |
gagcagaa-cctgtgccacccccggatgatgctgcgagtttgaatcagaacaatgatactggtgctgagttgggaggggatacccgcagggtgcaatccc |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37120528 |
gagcagaatcctgtgccacccccggatgatgctgcgagtttgaatcagaacaatgatactggtgctgagttgggaggggatacccgcagggtgcaatccc |
37120627 |
T |
 |
| Q |
102 |
ttttgcttcgaagatcacaatcacatagagcaacactttcaactctttcatcagcacttacttctgctgaaaggttggttgaggcatatttccgtagcaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37120628 |
ttttgcttcgaagatcacaatcacatagagcaacactttcaactctttcatcagcacttacttctgctgaaaggttggttgaggcatatttccgtagcaa |
37120727 |
T |
 |
| Q |
202 |
tccattgggcagaaaccaagaacaaccacctccttcaggtgatgacagggattcattttcaagcattgctgctgtcataaattcc |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37120728 |
tccattgggcagaaaccaagaacaaccacctccttcaggtgatgacagggattccttttcaagcattgctgctgtcataaattcc |
37120812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University