View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12161_low_2 (Length: 382)
Name: NF12161_low_2
Description: NF12161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12161_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 363
Target Start/End: Complemental strand, 20014798 - 20014445
Alignment:
| Q |
1 |
ttgatccaaatggacaattctctttgaaaacgggttcttgaagacaagtatggcattcatattgtgtgatatgccatttttagaaagatttgcaaaggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20014798 |
ttgatccaaatggacaattctctttgaaaacgggttcttgaagacaagtatgacattcatattgtgtgatatggcatttttagaaagatttgcaaaggtt |
20014699 |
T |
|
| Q |
101 |
tttgaagacaagtatgacatccatattgtgttattgttttcaatttggcgaatttggagggagcgaaacgattgaattttcaaagtgttatcttgacaat |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20014698 |
tttgaagacaagtatggcatccatattgtgttattgttttcaatttggcgaatttggagggag-----cgattgaattttcaaagtgttatcttgacaat |
20014604 |
T |
|
| Q |
201 |
agagtttaagcaaaggaaagattgcatcatgtttattctatgagctggcaccaagggattcttattttannnnnnnnngaaggaaggaggaaagggattc |
300 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
20014603 |
agagtttaagcaaaggaaatattgcatcatgtttattctatgagctggcaccaagggattcttttttt----ttttttgaaggaaggaggaaagggattc |
20014508 |
T |
|
| Q |
301 |
ttattatttgctaccaaaaaccttatagatttatagattttatgggttggcataggttctaaa |
363 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20014507 |
ttattatttgctaccaaaaaccttaaagatttatagattttatgggttggcataggtactaaa |
20014445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University