View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12163_high_5 (Length: 297)
Name: NF12163_high_5
Description: NF12163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12163_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 33791362 - 33791539
Alignment:
| Q |
17 |
aaaacgttggttcaatggtgtggtgttgaaggtaaggatccattggtgtttttggatcaaaacacttcttttgtgtttgatcatcaattttataatcaga |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33791362 |
aaaaggttggttcaatggtgtggtgttgaaggtaaggatccattagtgtttttggatcaaaacacttcttttgtttttgatcatcaattttataatcaga |
33791461 |
T |
 |
| Q |
117 |
ttttgttggggagaggtgtgttaacaattgaccagaatttggctctagattccatttccaaaggggttgtcacaggtt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33791462 |
ttttgttggggagaggtgtgttaacaattgaccagaatttggctctagattccatttccaaaggggttgtcacaggtt |
33791539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University