View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12163_low_6 (Length: 260)
Name: NF12163_low_6
Description: NF12163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12163_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 38267699 - 38267953
Alignment:
| Q |
1 |
ccaatcccctgtctgcgtcctgaatttgttccgagtggcgacacccctctacccgagagtcctcgagttcctatggagtttctgtcaagatcatggagtg |
100 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38267699 |
ccaatcacttgtctgcgtcctgaatttgttccgagtggcgacacccctctaccggagagtcctcgagttcctatggagtttctgtcaagatcatggagtg |
38267798 |
T |
 |
| Q |
101 |
cttcagctcttgaagtcacaaaagctcttgcaccacctcattcttcatgcatgccttcaaatggttctattcctgaagaaaccactaaccactctttatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38267799 |
cttcagctcttgaagtcacaaaagctcttgcaccacctcattcttcatgcatgccttcaaatggttctattcctgaagaaaccactaaccactctttatc |
38267898 |
T |
 |
| Q |
201 |
tgaagatctctctatacagtctaagaatcagttctcttttgcttcctatgctact |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38267899 |
tgaagatctctctatacagtctaagaatcagttctcttttgcttcctctgctact |
38267953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 42 - 112
Target Start/End: Original strand, 38311524 - 38311594
Alignment:
| Q |
42 |
cacccctctacccgagagtcctcgagttcctatggagtttctgtcaagatcatggagtgcttcagctcttg |
112 |
Q |
| |
|
||||||||| || || |||||| ||||||||||||||||||| |||| ||||||||||| |||| ||||| |
|
|
| T |
38311524 |
cacccctctgccgtagggtcctcaagttcctatggagtttctgccaaggtcatggagtgcatcagttcttg |
38311594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 113
Target Start/End: Complemental strand, 31709266 - 31709208
Alignment:
| Q |
55 |
gagagtcctcgagttcctatggagtttctgtcaagatcatggagtgcttcagctcttga |
113 |
Q |
| |
|
||||||||| || | || ||||||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
31709266 |
gagagtcctagaataccaatggagtttctttcaagatcatggagtgcctcagcttttga |
31709208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University