View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12164_high_25 (Length: 302)
Name: NF12164_high_25
Description: NF12164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12164_high_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 34 - 89
Target Start/End: Complemental strand, 24414383 - 24414328
Alignment:
| Q |
34 |
ttgttagtgaagaattgaagatttcttccttccatctattaattgtatcggtttga |
89 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24414383 |
ttgttagtgcagaattgaagatttcttccttccatctattaattgtatcggtttga |
24414328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 55 - 116
Target Start/End: Complemental strand, 439948 - 439887
Alignment:
| Q |
55 |
tttcttccttccatctattaattgtatcggtttgagaagctaaaagagagaaagcagtgtga |
116 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||||||||||||||||||||||| ||||||| |
|
|
| T |
439948 |
tttcttccttccatctgttaattgaattggtttgagaagctaaaagagagaaattagtgtga |
439887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 14983523 - 14983485
Alignment:
| Q |
1 |
ctgttaggttttagaattgaaatgctagtgtgtttgtta |
39 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
14983523 |
ctgttaggttttaaaattgaaatgttagtgtgtttgtta |
14983485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 198 - 242
Target Start/End: Complemental strand, 30397441 - 30397397
Alignment:
| Q |
198 |
ctatggtatttcttaggaatattttctagacgaacctatattgca |
242 |
Q |
| |
|
||||||||||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
30397441 |
ctatggtatttcttaagactgttttctagactaacctatattgca |
30397397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University