View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12167_low_3 (Length: 313)
Name: NF12167_low_3
Description: NF12167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12167_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 106 - 297
Target Start/End: Original strand, 43221862 - 43222053
Alignment:
| Q |
106 |
tttctgcttgtgccctatttaggttagcagctcaattattttttagagtaactggttattttactatgcagagaagaggtgaatgtgaaaaacaaggcgt |
205 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43221862 |
tttctgcctgtgccctatttaggttagcagctcaattattttttagagtaactggttattttactatgcagagaagaggtgaatgtgaaaaacaaggcgt |
43221961 |
T |
 |
| Q |
206 |
tgagtgcaagcaagtaaatggtggtaatgaagataacgatttggagagtgaagactatatctacaccaactcagtgttaccctagatcaaac |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43221962 |
tgagtgcaagcaagtaaatggtggtaatgaagataacgatttggagagtgaagactatatctacaccaactcagtgttaccctagatgaaac |
43222053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University