View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12168_low_8 (Length: 217)
Name: NF12168_low_8
Description: NF12168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12168_low_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 1713037 - 1712837
Alignment:
| Q |
16 |
gctctatactagttaatattcttaaaattagtaaaatacttcacaaaattatgatttaaagaacaacgacgacagnnnnnnntatccttaaacaaacaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1713037 |
gctctatactagttaatattcttaaaattagtaaa-tacttaacaaaattatgatttaaagaacaacgacgacagaaacaaatatccttaaacaaacaaa |
1712939 |
T |
 |
| Q |
116 |
catacataatcaacaagaggcaccttggtgattaaacaaggtaaggaagtagcatacagctctgcatatcatcgaaacaagcacagactccagaagacca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1712938 |
catacataatcaacaagaggcaccttggtgattaaacaaggtaaggaagtagcatacagctctgcatatcatcgaaacaagcacagattccagaagacca |
1712839 |
T |
 |
| Q |
216 |
tt |
217 |
Q |
| |
|
|| |
|
|
| T |
1712838 |
tt |
1712837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University