View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12169_low_10 (Length: 261)
Name: NF12169_low_10
Description: NF12169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12169_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 229
Target Start/End: Original strand, 52968518 - 52968742
Alignment:
| Q |
9 |
cagaacctgtgagatgtgtgggaacaaattctgattgaagaaactgacatatcagaaaaatggggtagagaaaccatta----attaattaatcactgtt |
104 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52968518 |
cagaatctgtgagatgtgtgggaacaaattctgattgaagaaactgacatatcagaaaaatggggtagagaaaccattaattaattaattaatcactgtt |
52968617 |
T |
 |
| Q |
105 |
tatattctattctattcccataaaaacagtaagcattacgacgaacgaatcaacaccaaagtttggggagggctgacacataatttttagagggagcaat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52968618 |
tatattctattctattcccataaaaacagtaagcattacgacgaacgaatcaacaccaaagtttggggagggctgacacataatttttagagggagcgat |
52968717 |
T |
 |
| Q |
205 |
gtctctcacaagactttggacacag |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52968718 |
gtctctcacaagactttggacacag |
52968742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University