View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12170_high_12 (Length: 336)
Name: NF12170_high_12
Description: NF12170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12170_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 4 - 225
Target Start/End: Complemental strand, 33757206 - 33756985
Alignment:
| Q |
4 |
atcatgaagagagtgaaagcattaaaagtggttcgaattggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgagga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33757206 |
atcatgaagagagtgaaagcattaaaagtggttcgaattggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgagga |
33757107 |
T |
 |
| Q |
104 |
gtcgtatcgttgaaggatcgagtggtggctgtgattgtttcacgcatatttggtttattagatttcctacggatgccggaagtgtcaccggtggttgctc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33757106 |
gtcgtatcgttgaaggatcgagtggtggttgtgattgtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctc |
33757007 |
T |
 |
| Q |
204 |
cgtcgccataactaactttcac |
225 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
33757006 |
cgtcgccataacaaactttcac |
33756985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University