View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12170_high_7 (Length: 354)
Name: NF12170_high_7
Description: NF12170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12170_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 13 - 133
Target Start/End: Complemental strand, 41325006 - 41324886
Alignment:
| Q |
13 |
tgaattcaacgtaacgtcaaaatagtctaggttgctctagcaaacaaaccaaatccaccatcaaaataagtttagcagtactataaacttagcataatat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41325006 |
tgaattcaacgtaacgtcaaaatagtctaggttgctctagcaaacaaaccaaatccaccatcaaaataagtttagcagtactataaactcagcataatat |
41324907 |
T |
|
| Q |
113 |
gttcaacaaaacgagctacag |
133 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41324906 |
gttcaacaaaacgagctacag |
41324886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 190 - 348
Target Start/End: Complemental strand, 41324829 - 41324671
Alignment:
| Q |
190 |
cctgataagccaacctaccctgcccttcattgctccaatatttccgtgggttaaacgaggctgacaaacatgtgtgattaccccatcnnnnnnnncatgt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41324829 |
cctgataagccaacctaccctgcccttcattgctccaatatttccgtgggttaaacgaggctgacaaacatgtgtgattaccccatcttttttttcatgt |
41324730 |
T |
|
| Q |
290 |
agtggtcggggtttgaatcacgaaccttgcatatttttatgcataccaactgagctaag |
348 |
Q |
| |
|
|||| | ||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41324729 |
ggtggccagggtttgaaccacgaaccttgcatatttttatgcataccaactgaactaag |
41324671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 291 - 329
Target Start/End: Complemental strand, 42051641 - 42051604
Alignment:
| Q |
291 |
gtggtcggggtttgaatcacgaaccttgcatatttttat |
329 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42051641 |
gtggtcggggtttgaatc-cgaaccttgcatatttttat |
42051604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 287 - 333
Target Start/End: Original strand, 33671552 - 33671598
Alignment:
| Q |
287 |
tgtagtggtcggggtttgaatcacgaaccttgcatatttttatgcat |
333 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
33671552 |
tgtagtggtcggggtttgaacctcgaaccttgcatatttttatgcat |
33671598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 289 - 333
Target Start/End: Original strand, 28550475 - 28550519
Alignment:
| Q |
289 |
tagtggtcggggtttgaatcacgaaccttgcatatttttatgcat |
333 |
Q |
| |
|
||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
28550475 |
tagtggttggggtttgaatcccggaccttgcatatttttatgcat |
28550519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 288 - 326
Target Start/End: Complemental strand, 23203393 - 23203355
Alignment:
| Q |
288 |
gtagtggtcggggtttgaatcacgaaccttgcatatttt |
326 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
23203393 |
gtagtggtcggggtttgaaccccgaaccttgcatatttt |
23203355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 291 - 333
Target Start/End: Original strand, 29450974 - 29451016
Alignment:
| Q |
291 |
gtggtcggggtttgaatcacgaaccttgcatatttttatgcat |
333 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||| |
|
|
| T |
29450974 |
gtggtcgggggttgaatcccgaaccttgcatattattatgcat |
29451016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 291 - 323
Target Start/End: Original strand, 7454571 - 7454603
Alignment:
| Q |
291 |
gtggtcggggtttgaatcacgaaccttgcatat |
323 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
7454571 |
gtggtcggggtttgaatcatgaaccttgcatat |
7454603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 326
Target Start/End: Complemental strand, 9598509 - 9598472
Alignment:
| Q |
289 |
tagtggtcggggtttgaatcacgaaccttgcatatttt |
326 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |
|
|
| T |
9598509 |
tagtggtcggggtttgaatctcggaccttgcatatttt |
9598472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University