View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12172_high_1 (Length: 543)
Name: NF12172_high_1
Description: NF12172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12172_high_1 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 6e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 361 - 543
Target Start/End: Complemental strand, 36576712 - 36576526
Alignment:
| Q |
361 |
ccttttcaaacaattatacattatta------cacacatttaacttcgataaactaatgttatactagaacatattttttaacgacttacacaaatgctg |
454 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||| |||||||||| |||| ||||||||| |
|
|
| T |
36576712 |
ccttttcaaacaattatacattattagtattacacacatttaacttcgataaactaatgttata-tagtacat--tttttaacgaattactcaaatgctg |
36576616 |
T |
|
| Q |
455 |
atgcatgtcttccttttagagaaatcatgcagcatggcatgttgagtagtcaatgaaaatgttttactatca-tgttgtgacataaagca |
543 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36576615 |
atgcatgtcttccttttagagaaatcatgcagcatggcatgttgagtagtcaatgaaaatgttttactatcagtgttgtgacataaagca |
36576526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 243 - 323
Target Start/End: Complemental strand, 36576877 - 36576798
Alignment:
| Q |
243 |
ctgtttcatgtaaacccaaatctgtatcgaccactcaaatcaatcctgaccaccctcctctagccaaccaatgcctcattc |
323 |
Q |
| |
|
||||||||||||||||| | ||||| | ||||| |||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36576877 |
ctgtttcatgtaaaccctagtctgtgcc-accacccaaatcaaccttgaccaccctcctctagccaaccaatgcctcattc |
36576798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University