View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12172_low_1 (Length: 268)
Name: NF12172_low_1
Description: NF12172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12172_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 72 - 239
Target Start/End: Complemental strand, 1140570 - 1140404
Alignment:
| Q |
72 |
ataactgtttctttctttctaaactatttggttgtcattgattggatgcagggactacaaccaaatgaactggttttagaagaagattgcaaggatgact |
171 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
1140570 |
ataaatgtttctttctttataa-ctatttggttgtcattgattggatgcagggactacaaccaaatgaactgattttatgagaagattgcaaggatgact |
1140472 |
T |
|
| Q |
172 |
caaactaactttcacatgtatttctcttttgatattaaaaaagaaacattcacactagagagagatgg |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1140471 |
caaactaactttcacatgaatttctcttttgatattaaaaaagaaacattcacactagagagagatgg |
1140404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 44515130 - 44515056
Alignment:
| Q |
1 |
agaacaatgggccccaaatactcatacccttagattaaatacagaatgtaactaggttcaaggaatatatgataa |
75 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44515130 |
agaacaatgggtcccaaatactcatacccttagattaaatacagaatgtaactaggttcaaggaatatatgataa |
44515056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University