View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12173_high_2 (Length: 640)
Name: NF12173_high_2
Description: NF12173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12173_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 554; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 554; E-Value: 0
Query Start/End: Original strand, 19 - 633
Target Start/End: Original strand, 35821362 - 35821976
Alignment:
| Q |
19 |
ggaaccccaatgggcatattcttcacgggggaatacatcgtacatctatgtagcaccaagacagtgggtttcggtgtgttcacatgtccgacacgcattg |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35821362 |
ggaaacccaatgggcatattcttcacgggggaatacatcgtacatctatgtagcaccaagacagtgggtttcggtgtgttcacgtgtccgacacgcattg |
35821461 |
T |
|
| Q |
119 |
gacaataacacacgtatgacactactcaccaggaagatcatgctcagacaaatgtccaaaaaacaaattcttactatggtatatcttcattgttcagaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35821462 |
gacaataacacacgtatgacactactcaccaggaagatcatgctcagacaaatgtccaaaaaacaaattcccactatggtatatcttcattgttcagaca |
35821561 |
T |
|
| Q |
219 |
gttgcagctacaatgagaatagatagggattcaaaaagtttcgacatatgcatgtcttcctttacttcggtcttcatcnnnnnnncatggtttccctttt |
318 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35821562 |
gtcgcagctacagtgagaatagatagggattcaaaaagtttcgacatatgcatgtcttcctttacttcggtcttcatctttttttcatggtttccctttt |
35821661 |
T |
|
| Q |
319 |
ctagtttccaattatgtttatgtttcggtcttcgtcttcagtctgtcacggagctctatctttgagtgacgtctcctttccttccactgcgccttatgtg |
418 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35821662 |
ctagtttccaattatgtttatgtttcgctcttcgtcttcagtctgtcacggagctctatcttcaagtgacgtctcctttccttccactgcgccttatgtg |
35821761 |
T |
|
| Q |
419 |
gtcaacgtctttgttatatttgcagttagcgtccgctttcagacatgtctcgttgttttgctttaatcttggtgtctcctcaaatgaagtctcttcttca |
518 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35821762 |
gtcaacgtctttgttatatttgcagttagcgtccgctttcagacatgtctcgttgttttgctttaatcttggtgtctcctcaaatgaagtctcttcttca |
35821861 |
T |
|
| Q |
519 |
gtctgcatcttcaatttgcattcactgcttcaggtacctctttgactggttacttgatggtttcaatagtagtttcatgatggaccggtttgaaaattat |
618 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35821862 |
gtctgcatcttcaatttgcattcactgcttcaggtacctctttgactggttacttgatggtttcaatagtagtttcatgatggaccggtttgaaaattat |
35821961 |
T |
|
| Q |
619 |
tctgccacaggttct |
633 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
35821962 |
tctgccacagtttct |
35821976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University