View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12173_low_14 (Length: 300)
Name: NF12173_low_14
Description: NF12173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12173_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 284
Target Start/End: Original strand, 10337202 - 10337470
Alignment:
| Q |
16 |
tgtgctagaataatttttgggnnnnnnnggtggactccaccgtccaaagaaggctatatatttatgtgcttctcctcactacacattaaggtgttaagtt |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10337202 |
tgtgctagaataatttttgggaaaaaaaggtggactccaccgtccaaagaaggctatatatttatgtgcttctcctcactacacattaaggtgttaagtt |
10337301 |
T |
 |
| Q |
116 |
aaaaggaacttcttaacttctttaagttctcaatcatcacctcatatcacaacttattgtcaattatcactactctcactttttctccttctttttcttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10337302 |
aaaaggaacttcttaacttctttaagttctcaatcatcacctcatatcacaacttattgtcaattatcactactctcactttttctccttctttttcttt |
10337401 |
T |
 |
| Q |
216 |
aaccatgccacaaaattgcatagcaccaaagcccgaatactttaatagtactctctctttggaaggatc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10337402 |
aaccatgccacaaaattgcatagcaccaaagccagaatactttaatagtactctctctttggaaggatc |
10337470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University