View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12173_low_20 (Length: 269)
Name: NF12173_low_20
Description: NF12173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12173_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 16 - 254
Target Start/End: Complemental strand, 29195345 - 29195107
Alignment:
| Q |
16 |
actttttatcttgggttttgccacaacaattgatgctcactttgatccaagctccctcgtcactcaagttctccccaatggtgatgcaagttactatgtc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29195345 |
actttttatcttgggttttgccacaacaattgatgctcactttgatccaagctccctcgtcactcaagttctccccaatggtgatgcaagttactatgtc |
29195246 |
T |
|
| Q |
116 |
aaaaaatcaacaaccacagcgacagcatgttgtgataaatgttattgcacaaaatcaaggcctcctcaatgtcattgtgcagatcttaataaaacttgca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29195245 |
aaaaaatcaacaaccacagcgacagcatgttgtgataaatgttattgcacaaaatcaaggcctcctcaatgtcattgtgcagatcttaataaaacttgca |
29195146 |
T |
|
| Q |
216 |
actcagcttgcaaactttgtgcatgtctaccatcaccac |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29195145 |
actcagcttgcaaactttgtgcatgtctaccatcaccac |
29195107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University