View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12173_low_21 (Length: 236)
Name: NF12173_low_21
Description: NF12173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12173_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 18681485 - 18681282
Alignment:
| Q |
18 |
acatattgcatggtttattgtaatatgagctatttgcaaaatttaatcatttaacaatttgacaatgttggtgaaggtatttgaagatgaaaacgaggca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18681485 |
acatattgcatggtttattgtaatatgagctatttgcaaaatttaatcatttaacaatttgacaatgttggtgaaggtatttgaagatgaaaacgaggca |
18681386 |
T |
 |
| Q |
118 |
gccaagtattgtgacttgctgcaaggaggttgtgagggtgttgccgagatagacgcctcatcggtacaaataaccaagcaattataatttgcctctagtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
18681385 |
gccaagtattgtgacttgctgcaaggaggttgtgagggtgttgccgagatagacgcctcatcggtacaaataaccaagcaattataatttgcctttaatc |
18681286 |
T |
 |
| Q |
218 |
tctg |
221 |
Q |
| |
|
|||| |
|
|
| T |
18681285 |
tctg |
18681282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University