View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12174_high_24 (Length: 242)
Name: NF12174_high_24
Description: NF12174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12174_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 233
Target Start/End: Original strand, 43541063 - 43541284
Alignment:
| Q |
12 |
ctgtggtggttagctataagaagcagaagaaggattatgaagataggattaagattcagaaagctgatgcggaagagagaaggaagatgagggagatgga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43541063 |
ctgtggtggttagctataagaagcagaagaaggattacgaagataggattaagattcagaaagctgatgcggaagagagaaggaagatgagggagatgga |
43541162 |
T |
|
| Q |
112 |
agccgagatggggtggagtgaagctggcggtgatgaggatgagagtgagctggtgaaagaaggagaggagaatccttatttgaaaatgacaaaggagttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43541163 |
agccgagatggggtggagtgaagctggcggtgatgaggatgagagtgagctggtgaaagaaggagaggagaatccttatttgaaaatgacaaaggagttt |
43541262 |
T |
|
| Q |
212 |
atgaaatctggggcacaggttc |
233 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
43541263 |
atgaaatctggggcacgggttc |
43541284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University