View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12174_high_30 (Length: 233)
Name: NF12174_high_30
Description: NF12174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12174_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 217
Target Start/End: Original strand, 40376758 - 40376954
Alignment:
| Q |
20 |
tgtacaagcgtgacagcttggcagcatcaactgttgctgatgtacaaggttttggatttttcttagttttggttaatgtggatctcatgattcatgaact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40376758 |
tgtacaagcgtgacagcttggcagcatcaactgttgctgatgtacaaggttttggatttttcttagttttggttaatgtggatctcatgattcatgaact |
40376857 |
T |
 |
| Q |
120 |
caatttaatctacagttattgattttgnnnnnnnngcttttgaaagggtttgatcgtcaacgtggaaatggtttgcttggttcaattcaattgacaca |
217 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40376858 |
caatttaatttacagttattgattttg-tttttttgcttttgaaagggtttgatcgtcaacgtggaaatggtttgcttggttcaattcaattgacaca |
40376954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University