View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12174_high_30 (Length: 233)

Name: NF12174_high_30
Description: NF12174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12174_high_30
NF12174_high_30
[»] chr3 (1 HSPs)
chr3 (20-217)||(40376758-40376954)


Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 217
Target Start/End: Original strand, 40376758 - 40376954
Alignment:
20 tgtacaagcgtgacagcttggcagcatcaactgttgctgatgtacaaggttttggatttttcttagttttggttaatgtggatctcatgattcatgaact 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40376758 tgtacaagcgtgacagcttggcagcatcaactgttgctgatgtacaaggttttggatttttcttagttttggttaatgtggatctcatgattcatgaact 40376857  T
120 caatttaatctacagttattgattttgnnnnnnnngcttttgaaagggtttgatcgtcaacgtggaaatggtttgcttggttcaattcaattgacaca 217  Q
    ||||||||| |||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40376858 caatttaatttacagttattgattttg-tttttttgcttttgaaagggtttgatcgtcaacgtggaaatggtttgcttggttcaattcaattgacaca 40376954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University