View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12174_low_22 (Length: 261)
Name: NF12174_low_22
Description: NF12174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12174_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 12 - 246
Target Start/End: Complemental strand, 7238781 - 7238558
Alignment:
| Q |
12 |
tgtaggtaatgaaaattcagagtccaattcagatcaagagtgagagggtggtggtgataacataataaaccccaacatttaagtttgnnnnnnngcttaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7238781 |
tgtaggtaatgaaaattcagagtccaattcagatcaagagtgagagggtggtg---ataacataataaaccccaacatttaagtttgtttttttgcttat |
7238685 |
T |
|
| Q |
112 |
tttgtaataagaagtgtgggtcagtacttggttttaattagacccaaacactacagtagtttatttttgtgaagcatgtgatgctcatgggtttcaactt |
211 |
Q |
| |
|
| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7238684 |
t--------acaagtgtgggtcagtacttggttttaattagacccaaacactacagtagtttatttttgtgaagcatgtgatgctcatgggtttcaactt |
7238593 |
T |
|
| Q |
212 |
taatcttgaaggcatatttatatttcacatgttta |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7238592 |
taatcttgaaggcatatttatatttcacatgttta |
7238558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University